ModCRE DB

Transcription factor

Q13118 - KLF10

Krueppel-like factor 10 (EGR-alpha) (Transforming growth factor-beta-inducible early growth response protein 1) (TGFB-inducible early growth response protein 1) (TIEG-1)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 480 aa

6 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known6
MotifPredictionSourceDNA bindingSupportLogoActions
MA1511.1 Known JASPAR GCCACACCCCC Direct PWM Open · Scan
MA1511.2 Known JASPAR GGGGCGGGG Direct PWM Open · Scan
M04489_2.00 Known CisBP GCCACACCCCCGCCACACCCCC Direct PWM Open · Scan
M04490_2.00 Known CisBP GCCACGCCCCCGCCACGCCCCC Direct PWM Open · Scan
M08246_2.00 Known CisBP GCCCCACCCA Direct PWM Open · Scan
M08317_2.00 Known CisBP GCCCCGCCCCCTCCC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 480 aa
185-214

Region 185-214 0 PWM

Residues
30 aa
Domains
No overlapping PFAM annotation recorded
3D models
1 active PDB
Templates
1A6Y
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 185-2141 model
Actions
Predicted = Low DIMER_Q13118:185:214_1a6y_A_1 1a6y 185-214 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
370-393PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
399-423PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
429-451PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions