ModCRE DB

Transcription factor

Q13360 - ZNF177

Zinc finger protein 177

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 481 aa

2 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known2
MotifPredictionSourceDNA bindingSupportLogoActions
M04615_2.00 Known CisBP CTCGATCGAAGGGCACAGTCATT Direct PWM Open · Scan
M04616_2.00 Known CisBP CTTGATCTAGGGGCACAGTCATT Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 481 aa
173-447

Region 173-447 0 PWM

Residues
275 aa
Domains
PF13465 · Zinc-finger double domain PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5WJQ
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 173-4471 model
Actions
Predicted = Low TFS_Q13360:173:447_5wjq_D_1 5wjq 173-447 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
13-54PF01352KRAB boxNo overlap with loaded model regions
298-323PF13465Zinc-finger double domainoverlaps 173-447
340-362PF00096Zinc finger, C2H2 typeoverlaps 173-447
368-390PF00096Zinc finger, C2H2 typeoverlaps 173-447
396-418PF00096Zinc finger, C2H2 typeoverlaps 173-447
424-446PF00096Zinc finger, C2H2 typeoverlaps 173-447
452-474PF13912C2H2-type zinc fingerNo overlap with loaded model regions