ModCRE DB

Transcription factor

Q13771 - AR

Androgen receptor (Dihydrotestosterone receptor) (Nuclear receptor subfamily 3 group C member 4)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 730 aa

24 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)4
MotifPredictionSourceDNA bindingSupportLogoActions
M09609_2.00 NN 70+% CisBP CCAGGAACAG 98.0% identity Open · Scan
MA0007.2 NN 70+% JASPAR AAGAACAGAATGTTC 97.8% identity Open · Scan
MA0007.1 NN 70+% JASPAR ATAAGAACACCCTGTACCCGCC 88.8% identity Open · Scan
MA0007.3 NN 70+% JASPAR GGGAACACGGTGTACCC 88.6% identity Open · Scan
Nearest Neighbor (70% - 40%)20
MotifPredictionSourceDNA bindingSupportLogoActions
M07987_2.00 NN 70-40% CisBP GCCCAGAACATTCTGTTCCCT 53.4% identity Open · Scan
MA1540.1 NN 70-40% JASPAR GTCAAGGTCAC 52.8% identity Open · Scan
M05669_2.00 NN 70-40% CisBP GAGGTCAT 51.4% identity Open · Scan
M08226_2.00 NN 70-40% CisBP CAAGGTCA 51.4% identity Open · Scan
MA0504.1 NN 70-40% JASPAR AGGGGTCAGAGGTCA 51.4% identity Open · Scan
M06417_2.00 NN 70-40% CisBP CAGTCCGAAGGTCACCGC 51.2% identity Open · Scan
MA0113.1 NN 70-40% JASPAR GGGAACATTATGTCCTAA 51.0% identity Open · Scan
M05590_2.00 NN 70-40% CisBP TTCAAGGTCAC 50.6% identity Open · Scan
M09616_2.00 NN 70-40% CisBP TTCAAGGTCA 50.6% identity Open · Scan
MA0505.1 NN 70-40% JASPAR AAGTTCAAGGTCAGC 50.6% identity Open · Scan
MA0727.1 NN 70-40% JASPAR GGGAACACAATGTTCCC 50.6% identity Open · Scan
M05886_2.00 NN 70-40% CisBP AGTACATTTTGTTCT 50.4% identity Open · Scan
M03382_2.00 NN 70-40% CisBP GGGAACACAATGTTCCC 50.3% identity Open · Scan
M00812_2.00 NN 70-40% CisBP AGAGGTCACG 50.0% identity Open · Scan
M05599_2.00 NN 70-40% CisBP AAAGGTCAA 50.0% identity Open · Scan
M05604_2.00 NN 70-40% CisBP TAAAGGTCAC 50.0% identity Open · Scan
MA0115.1 NN 70-40% JASPAR AAAGGTCAAAGGTCAAC 50.0% identity Open · Scan
MA1110.1 NN 70-40% JASPAR TCAATGACCTA 50.0% identity Open · Scan
MA1112.1 NN 70-40% JASPAR AAAAGGTCAC 50.0% identity Open · Scan
MA1535.1 NN 70-40% JASPAR CGAGGTCAC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 730 aa
359-431

Region 359-431 0 PWM

Residues
73 aa
Domains
PF00105 · Double treble clef zinc finger, C4 type
3D models
1 active PDB
Templates
4OOR
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 359-4311 model
Actions
Predicted = Low DIMER_Q13771:359:431_4oor_A_1 4oor 359-431 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
5-259PF02166Androgen receptorNo overlap with loaded model regions
361-429PF00105Double treble clef zinc finger, C4 typeoverlaps 359-431
502-688PF00104Ligand-binding domain of nuclear hormone receptorNo overlap with loaded model regions