Region 201-311 0 PWM
- Residues
- 111 aa
- Domains
- PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13465 · Zinc-finger double domain
- 3D models
- 1 active PDB
- Templates
- 6E93
- Sources
- Structure model
Transcription factor
Q14585 - ZNF345
Zinc finger protein 345 (Zinc finger protein HZF10)
Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 488 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known2
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M04653_2.00 | Known | CisBP | GGTACGGTTGTCCATGTTGCAA | Direct PWM | Open · Scan | |
| M04654_2.00 | Known | CisBP | TTGCAACACGAACAACTGTACC | Direct PWM | Open · Scan |
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
488 aa
201-311
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 201-3111 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_Q14585:201:311_6e93_A_1 | 6e93 | 201-311 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 63-84 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 90-112 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 118-140 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 146-168 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 174-196 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 202-224 | PF00096 | Zinc finger, C2H2 type | overlaps 201-311 |
| 230-252 | PF00096 | Zinc finger, C2H2 type | overlaps 201-311 |
| 272-297 | PF13465 | Zinc-finger double domain | overlaps 201-311 |
| 314-336 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 342-364 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 370-392 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 412-436 | PF13465 | Zinc-finger double domain | No overlap with loaded model regions |
| 454-476 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |