ModCRE DB

Transcription factor

Q14919 - DRAP1

Dr1-associated corepressor (Dr1-associated protein 1) (Negative cofactor 2-alpha) (NC2-alpha)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 205 aa

5 Generated PWM 5 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_Q14919_NC2A_HUMAN:10:75_1jfi_A_1 ModCRE Homology model CTAGGGGAGCCCCCGCT Region 10-75 · 1 3D model Open · Scan
TFS_sp_Q14919_NC2A_HUMAN:13:86_4wzs_A_1 ModCRE Homology model TAAAATCGCTCGCTGA Region 13-86 · 1 3D model Open · Scan
TFS_sp_Q14919_NC2A_HUMAN:13:87_4awl_C_1 ModCRE Homology model ATTTTAATATTTCCAAAATTTTTCT Region 13-87 · 1 3D model Open · Scan
TFS_sp_Q14919_NC2A_HUMAN:9:87_6r2v_C_1 ModCRE Homology model TTTAAAATTACAGCCCTGGGGGG Region 9-87 · 1 3D model Open · Scan
TFS_sp_Q14919_NC2A_HUMAN:9:87_7cvq_A_1 ModCRE Homology model AACTTAAAATTTTTGAAATTTT Region 9-87 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 205 aa
9-87

Region 9-87 5 PWM

Residues
79 aa
Domains
PF00808 · Histone-like transcription factor (CBF/NF-Y) and archaeal histone
3D models
5 active PDBs · 5 summary rows
Templates
1JFI, 4AWL, 4WZS, 6R2V, 7CVQ
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
5 active PDB models 5 summary rows
Region 9-875 models · 5 summary rows
Actions
Predicted = Low TFS_sp_Q14919_NC2A_HUMAN:10:75_1jfi_A_1 1jfi 10-75 View model · PDB
Predicted = Low TFS_sp_Q14919_NC2A_HUMAN:13:86_4wzs_A_1 4wzs 13-86 View model · PDB
Predicted = Low TFS_sp_Q14919_NC2A_HUMAN:13:87_4awl_C_1 4awl 13-87 View model · PDB
Predicted = Low TFS_sp_Q14919_NC2A_HUMAN:9:87_6r2v_C_1 6r2v 9-87 View model · PDB
Predicted = Low TFS_sp_Q14919_NC2A_HUMAN:9:87_7cvq_A_1 7cvq 9-87 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1jfi 3:87 10 75 P:A · DNA:D,E 95.5% / 95.5% 100 View · PDB TFS_sp_Q14919_NC2A_HUMAN:10:75_1jfi_A_1
3 4awl 3:87 13 87 P:C · DNA:I,J 36.0% / 60.0% 93 View · PDB TFS_sp_Q14919_NC2A_HUMAN:13:87_4awl_C_1
2 6r2v 3:87 9 87 P:C · DNA:I,J 34.2% / 57.0% 83 View · PDB TFS_sp_Q14919_NC2A_HUMAN:9:87_6r2v_C_1
4 7cvq 3:87 9 87 P:A · DNA:D,E 34.2% / 57.0% 63 View · PDB TFS_sp_Q14919_NC2A_HUMAN:9:87_7cvq_A_1
5 4wzs 3:87 13 86 P:A · DNA:E,F 32.4% / 60.8% 98 View · PDB TFS_sp_Q14919_NC2A_HUMAN:13:86_4wzs_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
10-74PF00808Histone-like transcription factor (CBF/NF-Y) and archaeal histoneoverlaps 9-87