ModCRE DB

Transcription factor

Q14995 - NR1D2

Nuclear receptor subfamily 1 group D member 2 (Orphan nuclear hormone receptor BD73) (Rev-erb alpha-related receptor) (RVR) (Rev-erb-beta) (V-erbA-related protein 1-related) (EAR-1R)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 579 aa

4 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known4
MotifPredictionSourceDNA bindingSupportLogoActions
M05660_2.00 Known CisBP GATGTGGGTCAGTGGGTCAG Direct PWM Open · Scan
MA1532.1 Known JASPAR GGGTTAGTGGGTCAT Direct PWM Open · Scan
MA1532.2 Known JASPAR TGGGTTAGTAGGTCA Direct PWM Open · Scan
M05659_2.00 Known CisBP TATGTGGGTTAGTGGGTCAT Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 579 aa
100-180

Region 100-180 0 PWM

Residues
81 aa
Domains
PF00105 · Double treble clef zinc finger, C4 type
3D models
1 active PDB
Templates
1HLZ
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 100-1801 model
Actions
Predicted = Low DIMER_Q14995:100:180_1hlz_A_1 1hlz 100-180 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
102-171PF00105Double treble clef zinc finger, C4 typeoverlaps 100-180
403-577PF00104Ligand-binding domain of nuclear hormone receptorNo overlap with loaded model regions