Transcription factor

Q15928 - ZNF141

Zinc finger protein 141

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 474 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M07586_2.00	Known	CisBP	GGGACCCGGGTGGGGGCGTCCCCC	Direct PWM		Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 474 aa

174-446

Residues: 273 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13912 · C2H2-type zinc finger PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 1 active PDB
Templates: 5V3J
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 174-4461 model

				Actions
Predicted = Low	TFS_Q15928:174:446_5v3j_E_1	5v3j	174-446	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
4-44	PF01352	KRAB box	No overlap with loaded model regions
227-249	PF00096	Zinc finger, C2H2 type	overlaps 174-446
255-277	PF00096	Zinc finger, C2H2 type	overlaps 174-446
284-305	PF00096	Zinc finger, C2H2 type	overlaps 174-446
311-333	PF00096	Zinc finger, C2H2 type	overlaps 174-446
339-361	PF00096	Zinc finger, C2H2 type	overlaps 174-446
367-389	PF13912	C2H2-type zinc finger	overlaps 174-446
395-417	PF00096	Zinc finger, C2H2 type	overlaps 174-446
423-445	PF00096	Zinc finger, C2H2 type	overlaps 174-446
451-473	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions