ModCRE DB

Transcription factor

Q16365

Transcription factor GATA-4 (GATA-binding factor 4)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 439 aa

25 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)12
MotifPredictionSourceDNA bindingSupportLogoActions
MA0482.2 NN 70+% JASPAR TTCCTTATCTTT 99.2% identity Open · Scan
M04875_2.00 NN 70+% CisBP GAGATAACGC 98.9% identity Open · Scan
MA0482.1 NN 70+% JASPAR TCTTATCTCCC 92.8% identity Open · Scan
M00166_2.00 NN 70+% CisBP TAGAGATAAG 85.4% identity Open · Scan
M10587_2.00 NN 70+% CisBP AGAGATAAGA 85.4% identity Open · Scan
MA0037.1 NN 70+% JASPAR AGATAG 85.4% identity Open · Scan
MA0036.1 NN 70+% JASPAR GGATA 82.7% identity Open · Scan
M10581_2.00 NN 70+% CisBP GCAGATAACA 80.0% identity Open · Scan
MA1104.1 NN 70+% JASPAR AAAAGATAAGAAA 79.0% identity Open · Scan
MA0035.4 NN 70+% JASPAR TTCTAATCTAT 78.8% identity Open · Scan
MA0035.1 NN 70+% JASPAR GGATGG 77.9% identity Open · Scan
MA0766.1 NN 70+% JASPAR AGATAAGA 70.0% identity Open · Scan
Nearest Neighbor (70% - 40%)13
MotifPredictionSourceDNA bindingSupportLogoActions
M02007_2.00 NN 70-40% CisBP TTACAGATCT 60.7% identity Open · Scan
M02017_2.00 NN 70-40% CisBP CAGATAAG 58.8% identity Open · Scan
M02019_2.00 NN 70-40% CisBP TTAGAGATCT 57.8% identity Open · Scan
M01231_2.00 NN 70-40% CisBP CTGATAAG 57.4% identity Open · Scan
M02012_2.00 NN 70-40% CisBP ACGATCGA 53.3% identity Open · Scan
M06888_2.00 NN 70-40% CisBP TTCAGATCTGAATC 52.9% identity Open · Scan
M02009_2.00 NN 70-40% CisBP CCGATCGA 52.6% identity Open · Scan
M03761_2.00 NN 70-40% CisBP GCGATAAG 52.2% identity Open · Scan
M01545_2.00 NN 70-40% CisBP AGATAAG 52.0% identity Open · Scan
M06897_2.00 NN 70-40% CisBP ATGATGATGATGATGATGATGATGATG 51.7% identity Open · Scan
M06885_2.00 NN 70-40% CisBP TCGATCGGATTAG 51.5% identity Open · Scan
M00052_2.00 NN 70-40% CisBP ACGATATCGT 50.8% identity Open · Scan
M02013_2.00 NN 70-40% CisBP CCCGATCG 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 439 aa
211-315

Region 211-315 0 PWM

Residues
105 aa
Domains
PF00320 · GATA zinc finger PF00320 · GATA zinc finger
3D models
1 active PDB
Templates
4HC7
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 211-3151 model
Actions
Predicted = Low TFS_Q16365:211:315_4hc7_A_1 4hc7 211-315 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
81-201PF05349GATA-type transcription activator, N-terminalNo overlap with loaded model regions
214-246PF00320GATA zinc fingeroverlaps 211-315
268-301PF00320GATA zinc fingeroverlaps 211-315