Transcription factor

Q1M183 - HMGA2

HMGA2e

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 147 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M07693_2.00	NN 70+%	CisBP	CTCCTGTGTGTGCCTTGGCTG	86.9% identity		Open · Scan

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

AF3 model assignments

Validated exact-accession AF3 models stored in local staging. Confidence artifacts are indexed but not visualized yet.

1 active AF3 model

Type	Model	Residues / fragment	Interface	Confidence files	Actions
AF3 full-length model	Q1M183_model.cif	Full sequence	PASS_NONEMPTY_PROTEIN_DNA_INTERFACE	3 indexed	View model · mmCIF

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.