Transcription factor

Q1MSX0 - TP53

Cellular tumor antigen p53

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 382 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M11197_2.00	Known	CisBP	AGACATGCCCGGGCATGTCC	Direct PWM		Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 382 aa

94-344

Residues: 251 aa
Domains: PF00870 · P53 DNA-binding domain PF07710 · P53 tetramerisation motif
3D models: 1 active PDB
Templates: 3Q05
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 94-3441 model

				Actions
Predicted = Low	TFS_Q1MSX0:94:344_3q05_A_1	3q05	94-344	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
6-30	PF08563	P53 transactivation motif	No overlap with loaded model regions
35-59	PF18521	Transactivation domain 2	No overlap with loaded model regions
112-277	PF00870	P53 DNA-binding domain	overlaps 94-344
308-346	PF07710	P53 tetramerisation motif	overlaps 94-344