ModCRE DB

Transcription factor

Q1RMZ5 - ZBTB40

ZBTB40 protein

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1127 aa

7 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M00640_2.00 NN 70-40% CisBP TGTGTGTG 50.0% identity Open · Scan
ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_Q1RMZ5_Q1RMZ5_HUMAN:779:832_1llm_C_1 ModCRE Homology model CTTCGCGCGGGT Region 779-832 · 1 3D model Open · Scan
TFS_tr_Q1RMZ5_Q1RMZ5_HUMAN:694:916_5v3j_E_1 ModCRE Homology model ACGGGCTTGGAGGGGCCCCCCCG Region 694-916 · 1 3D model Open · Scan
TFS_tr_Q1RMZ5_Q1RMZ5_HUMAN:694:916_5v3m_C_1 ModCRE Homology model ATTGGGGTTGGCCCGCCCCAGGGT Region 694-916 · 1 3D model Open · Scan
TFS_tr_Q1RMZ5_Q1RMZ5_HUMAN:694:981_5wjq_D_1 ModCRE Homology model GGTAAAGGGGGTTGGCATGCCCCGTGAG Region 694-981 · 1 3D model Open · Scan
TFS_tr_Q1RMZ5_Q1RMZ5_HUMAN:697:1010_7w1m_H_1 ModCRE Homology model AGTTCTTTGAGGGTAGTTTAACCCCAGCCGGGGGGCACATTTT Region 697-1010 · 1 3D model Open · Scan
TFS_tr_Q1RMZ5_Q1RMZ5_HUMAN:761:916_2i13_A_1 ModCRE Homology model GTACACGAGTAATAGATCCTT Region 761-916 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1127 aa
694-1010

Region 694-1010 6 PWM

Residues
317 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5V3J, 5V3M, 5WJQ, 7W1M
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 694-10106 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_Q1RMZ5_Q1RMZ5_HUMAN:779:832_1llm_C_1 1llm 779-832 View model · PDB
Predicted = Low TFS_tr_Q1RMZ5_Q1RMZ5_HUMAN:694:916_5v3j_E_1 5v3j 694-916 View model · PDB
Predicted = Low TFS_tr_Q1RMZ5_Q1RMZ5_HUMAN:694:916_5v3m_C_1 5v3m 694-916 View model · PDB
Predicted = Low TFS_tr_Q1RMZ5_Q1RMZ5_HUMAN:694:981_5wjq_D_1 5wjq 694-981 View model · PDB
Predicted = Low TFS_tr_Q1RMZ5_Q1RMZ5_HUMAN:697:1010_7w1m_H_1 7w1m 697-1010 View model · PDB
Predicted = Low TFS_tr_Q1RMZ5_Q1RMZ5_HUMAN:761:916_2i13_A_1 2i13 761-916 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
5 2i13 691:1010 761 916 P:A · DNA:C,D 40.4% / 51.9% 100 View · PDB TFS_tr_Q1RMZ5_Q1RMZ5_HUMAN:761:916_2i13_A_1
1 1llm 691:1010 779,779 832,832 P:C,D · DNA:A,B 37.0% / 59.3% 62,63 View · PDB DIMER_tr_Q1RMZ5_Q1RMZ5_HUMAN:779:832_1llm_C_1
2 5v3m 691:1010 694 916 P:C · DNA:A,B 35.4% / 52.0% 79 View · PDB TFS_tr_Q1RMZ5_Q1RMZ5_HUMAN:694:916_5v3m_C_1
3 5v3j 691:1010 694 916 P:E · DNA:A,B 35.4% / 52.0% 79 View · PDB TFS_tr_Q1RMZ5_Q1RMZ5_HUMAN:694:916_5v3j_E_1
1 5wjq 691:1010 694 981 P:D · DNA:A,B 33.3% / 48.3% 96 View · PDB TFS_tr_Q1RMZ5_Q1RMZ5_HUMAN:694:981_5wjq_D_1
4 7w1m 691:1010 697 1010 P:H · DNA:F,G 28.3% / 41.7% 92 View · PDB TFS_tr_Q1RMZ5_Q1RMZ5_HUMAN:697:1010_7w1m_H_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
17-114PF00651BTB/POZ domainNo overlap with loaded model regions
724-746PF00096Zinc finger, C2H2 typeoverlaps 694-1010
781-803PF00096Zinc finger, C2H2 typeoverlaps 694-1010
809-832PF00096Zinc finger, C2H2 typeoverlaps 694-1010
866-888PF00096Zinc finger, C2H2 typeoverlaps 694-1010
1025-1044PF12874Zinc-finger of C2H2 typeNo overlap with loaded model regions