ModCRE DB

Transcription factor

Q2A130 - AVGR5

Autogenous vein graft remodeling associated protein 5

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 465 aa

23 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2
MotifPredictionSourceDNA bindingSupportLogoActions
M07650_2.00 NN 70+% CisBP GGTCTATAAAAGGGGGGCCGCGGGGGGG 73.6% identity Open · Scan
M07628_2.00 NN 70+% CisBP AGTGGTTCTGCTTCT 71.4% identity Open · Scan
Nearest Neighbor (70% - 40%)21
MotifPredictionSourceDNA bindingSupportLogoActions
M07674_2.00 NN 70-40% CisBP AAATCCTTGACAATCAAGGGTTCCCTCAC 61.6% identity Open · Scan
M07763_2.00 NN 70-40% CisBP AGAGGTTTCTT 57.3% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 56.6% identity Open · Scan
M00645_2.00 NN 70-40% CisBP CGCCCACGCA 56.1% identity Open · Scan
M08386_2.00 NN 70-40% CisBP GCCTTAAAAGCTCAGCAC 56.1% identity Open · Scan
M08540_2.00 NN 70-40% CisBP CCCCT 56.0% identity Open · Scan
M01538_2.00 NN 70-40% CisBP GCCCCTGA 55.1% identity Open · Scan
M07757_2.00 NN 70-40% CisBP CCGCGGCC 55.0% identity Open · Scan
M07756_2.00 NN 70-40% CisBP GCGGCA 54.8% identity Open · Scan
MA1583.1 NN 70-40% JASPAR GCATTGCCGCAGT 54.8% identity Open · Scan
M06072_2.00 NN 70-40% CisBP CCACGCCCACGCAC 52.4% identity Open · Scan
M09515_2.00 NN 70-40% CisBP CCCGCCCACGCA 52.4% identity Open · Scan
MA0162.1 NN 70-40% JASPAR TGCGTGGGCGG 52.4% identity Open · Scan
MA0162.2 NN 70-40% JASPAR CCCCCGCCCCCGCC 52.4% identity Open · Scan
MA0472.1 NN 70-40% JASPAR CCCCCGCCCACGCAC 52.4% identity Open · Scan
MA0472.2 NN 70-40% JASPAR ACGCCCACGCA 52.4% identity Open · Scan
MA0733.1 NN 70-40% JASPAR TTACGCCCACGCATTT 52.4% identity Open · Scan
M01186_2.00 NN 70-40% CisBP TACCCCGCAC 51.5% identity Open · Scan
M01440_2.00 NN 70-40% CisBP TACGCCAC 51.1% identity Open · Scan
M01042_2.00 NN 70-40% CisBP TGGGACCTGA 50.0% identity Open · Scan
MA1592.1 NN 70-40% JASPAR GGTATGAGTTCTCGCT 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 465 aa
322-425

Region 322-425 0 PWM

Residues
104 aa
Domains
No overlapping PFAM annotation recorded
3D models
1 active PDB
Templates
5EGB
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 322-4251 model
Actions
Predicted = Low TFS_Q2A130:322:425_5egb_A_1 5egb 322-425 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
29-70PF01352KRAB boxNo overlap with loaded model regions
101-142PF17490L1 transposable element dsRBD-like domainNo overlap with loaded model regions