ModCRE DB

Transcription factor

Q3B799 - ZNF33B

ZNF33B protein

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 606 aa

70 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M08263_2.00 NN 70+% CisBP ATCTCGGCACTTTGGGAGGCCA 92.2% identity Open · Scan
Nearest Neighbor (70% - 40%)69
MotifPredictionSourceDNA bindingSupportLogoActions
M00953_2.00 NN 70-40% CisBP ATCTATAT 68.1% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 65.8% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 65.8% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 64.7% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 64.7% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 64.7% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 63.6% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 63.6% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 63.6% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 63.6% identity Open · Scan
MA1124.1 NN 70-40% JASPAR CATTCATTCATTC 62.3% identity Open · Scan
M04387_2.00 NN 70-40% CisBP CGTGCTCCCC 60.3% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 60.0% identity Open · Scan
M08365_2.00 NN 70-40% CisBP GCCAGCAGCCATCAG 59.9% identity Open · Scan
M08329_2.00 NN 70-40% CisBP GCTGCATAGTATTCC 58.5% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 58.4% identity Open · Scan
M04598_2.00 NN 70-40% CisBP CGCTAACTCTCCACA 58.2% identity Open · Scan
M08342_2.00 NN 70-40% CisBP GCTCTGCCTCCCTCT 58.2% identity Open · Scan
M07613_2.00 NN 70-40% CisBP TCACTCAGTCATTCA 57.9% identity Open · Scan
M07683_2.00 NN 70-40% CisBP GTGGGAAAGCCT 57.2% identity Open · Scan
MA1601.1 NN 70-40% JASPAR ATGTGGGAAA 57.2% identity Open · Scan
M04621_2.00 NN 70-40% CisBP AGCAATTCCGCTCA 56.4% identity Open · Scan
M08901_2.00 NN 70-40% CisBP CCAGTTCACACC 56.4% identity Open · Scan
M04613_2.00 NN 70-40% CisBP CTCATGTGCTAATTACAAA 55.7% identity Open · Scan
M04505_2.00 NN 70-40% CisBP AGCTTTTCCCACAC 55.4% identity Open · Scan
M07620_2.00 NN 70-40% CisBP TTGGATCTGTGGATTCATGTCTTTCAT 55.4% identity Open · Scan
M07649_2.00 NN 70-40% CisBP CCCCCCCCCCCCTCAGGAATGCC 55.3% identity Open · Scan
M08325_2.00 NN 70-40% CisBP TTTTTTTTT 55.2% identity Open · Scan
M07618_2.00 NN 70-40% CisBP CCTTTGGTGCTC 55.1% identity Open · Scan
M07678_2.00 NN 70-40% CisBP CCCGCCCCCTCCTCCCCCTTCCCACCC 55.1% identity Open · Scan
M08355_2.00 NN 70-40% CisBP GCGAACTCCTATTCATCC 54.8% identity Open · Scan
M08887_2.00 NN 70-40% CisBP CCTCCTCCAGGAAGCCTTCCCTGA 54.8% identity Open · Scan
M07633_2.00 NN 70-40% CisBP CTCTCGTTGTGCCTTTGCCAT 54.7% identity Open · Scan
M08334_2.00 NN 70-40% CisBP TTTGTTTTTTTCTGATTGCTTTTTACTTAT 54.6% identity Open · Scan
MA0528.1 NN 70-40% JASPAR GGAGGAGGAGGGGGAGGAGGA 54.6% identity Open · Scan
M07578_2.00 NN 70-40% CisBP CAACTCTCC 54.4% identity Open · Scan
M07610_2.00 NN 70-40% CisBP CCTTCTTCCTCCCCCCTGCCCACC 53.8% identity Open · Scan
M08254_2.00 NN 70-40% CisBP CTGCCCTGGGACTTT 53.8% identity Open · Scan
M05855_2.00 NN 70-40% CisBP GTATTATACCCAGCT 53.6% identity Open · Scan
MA1596.1 NN 70-40% JASPAR GCCTCAGCCTCCCGAG 53.6% identity Open · Scan
M08357_2.00 NN 70-40% CisBP GAGCCTGCTACTGAGCCTGGG 53.2% identity Open · Scan
M08917_2.00 NN 70-40% CisBP GCTGAGCCATGTGGGGTGCT 53.1% identity Open · Scan
M07582_2.00 NN 70-40% CisBP TCCCTG 52.9% identity Open · Scan
M08375_2.00 NN 70-40% CisBP TTCCCCATTGGCTACTGCACCGGTCCT 52.8% identity Open · Scan
M08373_2.00 NN 70-40% CisBP CCCCCTGGCTCTTCCTCT 52.7% identity Open · Scan
M04465_2.00 NN 70-40% CisBP GTGATTCTTATCTTATCCTT 52.5% identity Open · Scan
M01538_2.00 NN 70-40% CisBP GCCCCTGA 52.3% identity Open · Scan
M00609_2.00 NN 70-40% CisBP GGAAGCCCTA 52.2% identity Open · Scan
M00945_2.00 NN 70-40% CisBP CACCGCAC 52.2% identity Open · Scan
M08309_2.00 NN 70-40% CisBP AAAAACCCCCCTGCAGAGCCCAGCCCT 52.1% identity Open · Scan
M07588_2.00 NN 70-40% CisBP TCCTTCCCTCTTTCC 51.8% identity Open · Scan
MA1154.1 NN 70-40% JASPAR CTTTCCCACAACACGAC 51.7% identity Open · Scan
M07777_2.00 NN 70-40% CisBP GCCAATTTCCGTGGTGTAAAT 51.6% identity Open · Scan
M08859_2.00 NN 70-40% CisBP CATTTTTTCCTCCTAGGCCT 51.6% identity Open · Scan
M07656_2.00 NN 70-40% CisBP TGTCTAGTAAGTCTA 51.4% identity Open · Scan
M08234_2.00 NN 70-40% CisBP GTCAACTTGACTGGGCCA 51.3% identity Open · Scan
MA1656.1 NN 70-40% JASPAR CCAAGCCCAACCAG 51.2% identity Open · Scan
M00782_2.00 NN 70-40% CisBP AGTGTGCGCTA 51.1% identity Open · Scan
M07753_2.00 NN 70-40% CisBP TGCATTCCTTGGCTTGTG 51.1% identity Open · Scan
M04536_2.00 NN 70-40% CisBP ACGTAACCCGATACC 51.0% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 50.9% identity Open · Scan
M07702_2.00 NN 70-40% CisBP CTTCTTCCTTGG 50.9% identity Open · Scan
M03671_2.00 NN 70-40% CisBP ATTACCATACAAGTGCAC 50.8% identity Open · Scan
M07607_2.00 NN 70-40% CisBP GGCTCCACG 50.6% identity Open · Scan
M07667_2.00 NN 70-40% CisBP CCGCACAGGCCCCCGGGCCCC 50.3% identity Open · Scan
M00786_2.00 NN 70-40% CisBP TATATATAT 50.2% identity Open · Scan
M04590_2.00 NN 70-40% CisBP TGCGCTAACCATTGC 50.0% identity Open · Scan
M07587_2.00 NN 70-40% CisBP CCCCCTCCCCAGTCGAGCCCCCGC 50.0% identity Open · Scan
M08283_2.00 NN 70-40% CisBP GACTTTTATTTT 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 606 aa
301-576

Region 301-576 0 PWM

Residues
276 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5V3J
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 301-5761 model
Actions
Predicted = Low TFS_Q3B799:301:576_5v3j_E_1 5v3j 301-576 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
11-52PF01352KRAB boxNo overlap with loaded model regions
329-351PF00096Zinc finger, C2H2 typeoverlaps 301-576
357-379PF00096Zinc finger, C2H2 typeoverlaps 301-576
385-407PF00096Zinc finger, C2H2 typeoverlaps 301-576
413-435PF00096Zinc finger, C2H2 typeoverlaps 301-576
441-463PF00096Zinc finger, C2H2 typeoverlaps 301-576
469-491PF00096Zinc finger, C2H2 typeoverlaps 301-576
497-519PF00096Zinc finger, C2H2 typeoverlaps 301-576
525-547PF00096Zinc finger, C2H2 typeoverlaps 301-576
553-575PF00096Zinc finger, C2H2 typeoverlaps 301-576
581-598PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions