Transcription factor

Q3KQV3 - ZNF792

Zinc finger protein 792

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 632 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M07660_2.00	Known	CisBP	CCGCGCCTACCTGAGGGCGCGGGCCTGGGG	Direct PWM		Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 632 aa

308-584

Residues: 277 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 1 active PDB
Templates: 5WJQ
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 308-5841 model

				Actions
Predicted = Low	TFS_Q3KQV3:308:584_5wjq_D_1	5wjq	308-584	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
13-54	PF01352	KRAB box	No overlap with loaded model regions
282-304	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
310-332	PF00096	Zinc finger, C2H2 type	overlaps 308-584
338-360	PF00096	Zinc finger, C2H2 type	overlaps 308-584
366-388	PF00096	Zinc finger, C2H2 type	overlaps 308-584
394-416	PF00096	Zinc finger, C2H2 type	overlaps 308-584
422-444	PF00096	Zinc finger, C2H2 type	overlaps 308-584
452-472	PF00096	Zinc finger, C2H2 type	overlaps 308-584
478-500	PF00096	Zinc finger, C2H2 type	overlaps 308-584
506-528	PF00096	Zinc finger, C2H2 type	overlaps 308-584
534-556	PF00096	Zinc finger, C2H2 type	overlaps 308-584
562-584	PF00096	Zinc finger, C2H2 type	overlaps 308-584