Region 779-1057 3 PWM
- Residues
- 279 aa
- Domains
- PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
- 3D models
- 6 active PDBs · 6 summary rows
- Templates
- 1LLM, 5T0U, 7W1M, 8SSR, 8SSS, 8SST
- Sources
- Predicted = Low
Transcription factor
Q4KMQ4 - ZFAT
Zinc finger protein ZFAT (Zinc finger protein 406)
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1204 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known0
No generated PWM in this category.
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M07842_2.00 | NN 70-40% | CisBP | CTCACCTG | 61.7% identity | Open · Scan |
ModCRE3
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| TFS_tr_Q4KMQ4_Q4KMQ4_HUMAN:841:1026_8sss_A_1 | ModCRE | Homology model | TCCAGAGGCCCCCCCCCCGCCGC | Region 841-1026 · 1 3D model | Open · Scan | |
| TFS_tr_Q4KMQ4_Q4KMQ4_HUMAN:841:1026_8sst_A_1 | ModCRE | Homology model | CCTCGAGGCGCCGCCCCCGCGGG | Region 841-1026 · 1 3D model | Open · Scan | |
| TFS_tr_Q4KMQ4_Q4KMQ4_HUMAN:914:1027_5t0u_A_1 | ModCRE | Homology model | GCTCAAAGGCCAGGTTAT | Region 914-1027 · 1 3D model | Open · Scan |
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
1204 aa
779-1057
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models
6 summary rows
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 779-10576 models · 6 summary rows
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | DIMER_tr_Q4KMQ4_Q4KMQ4_HUMAN:942:992_1llm_C_1 | 1llm | 942-992 | View model · PDB |
| Predicted = Low | TFS_tr_Q4KMQ4_Q4KMQ4_HUMAN:779:1022_8ssr_A_1 | 8ssr | 779-1022 | View model · PDB |
| Predicted = Low | TFS_tr_Q4KMQ4_Q4KMQ4_HUMAN:841:1026_8sss_A_1 | 8sss | 841-1026 | View model · PDB |
| Predicted = Low | TFS_tr_Q4KMQ4_Q4KMQ4_HUMAN:841:1026_8sst_A_1 | 8sst | 841-1026 | View model · PDB |
| Predicted = Low | TFS_tr_Q4KMQ4_Q4KMQ4_HUMAN:841:1057_7w1m_H_1 | 7w1m | 841-1057 | View model · PDB |
| Predicted = Low | TFS_tr_Q4KMQ4_Q4KMQ4_HUMAN:914:1027_5t0u_A_1 | 5t0u | 914-1027 | View model · PDB |
Model-summary evidence imported for this region.
| Rank | Template | Domain | N-tails | C-tails | Chains | Identity / similarity | Coverage | Model file |
|---|---|---|---|---|---|---|---|---|
| 4 | 5t0u | 779:1057 | 914 | 1027 | P:A · DNA:B,C | 41.7% / 55.7% | 66 | View · PDB TFS_tr_Q4KMQ4_Q4KMQ4_HUMAN:914:1027_5t0u_A_1 |
| 1 | 1llm | 779:1057 | 942,942 | 992,992 | P:C,D · DNA:A,B | 35.3% / 52.9% | 58,60 | View · PDB DIMER_tr_Q4KMQ4_Q4KMQ4_HUMAN:942:992_1llm_C_1 |
| 1 | 8sss | 779:1057 | 841 | 1026 | P:A · DNA:B,C | 34.5% / 51.5% | 92 | View · PDB TFS_tr_Q4KMQ4_Q4KMQ4_HUMAN:841:1026_8sss_A_1 |
| 2 | 8sst | 779:1057 | 841 | 1026 | P:A · DNA:B,C | 34.5% / 51.5% | 92 | View · PDB TFS_tr_Q4KMQ4_Q4KMQ4_HUMAN:841:1026_8sst_A_1 |
| 3 | 7w1m | 779:1057 | 841 | 1057 | P:H · DNA:F,G | 32.6% / 51.1% | 66 | View · PDB TFS_tr_Q4KMQ4_Q4KMQ4_HUMAN:841:1057_7w1m_H_1 |
| 5 | 8ssr | 779:1057 | 779 | 1022 | P:A · DNA:B,C | 28.3% / 45.0% | 91 | View · PDB TFS_tr_Q4KMQ4_Q4KMQ4_HUMAN:779:1022_8ssr_A_1 |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 307-329 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 335-358 | PF13909 | C2H2-type zinc-finger domain | No overlap with loaded model regions |
| 945-967 | PF00096 | Zinc finger, C2H2 type | overlaps 779-1057 |
| 975-995 | PF00096 | Zinc finger, C2H2 type | overlaps 779-1057 |