ModCRE DB

Transcription factor

Q53EM3

Krueppel-related zinc finger protein 1 (HKR1 protein) variant

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 730 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07662_2.00 Known CisBP CCTGTGTCCTCCCTGGTCCCC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 730 aa
306-584

Region 306-584 0 PWM

Residues
279 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5WJQ
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 306-5841 model
Actions
Predicted = Low TFS_Q53EM3:306:584_5wjq_D_1 5wjq 306-584 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
68-107PF01352KRAB boxNo overlap with loaded model regions
150-167PF21225C2H2-type zinc fingerNo overlap with loaded model regions
337-359PF00096Zinc finger, C2H2 typeoverlaps 306-584
365-387PF00096Zinc finger, C2H2 typeoverlaps 306-584
393-415PF00096Zinc finger, C2H2 typeoverlaps 306-584
421-443PF00096Zinc finger, C2H2 typeoverlaps 306-584
449-471PF00096Zinc finger, C2H2 typeoverlaps 306-584
477-499PF00096Zinc finger, C2H2 typeoverlaps 306-584
505-527PF00096Zinc finger, C2H2 typeoverlaps 306-584
533-555PF00096Zinc finger, C2H2 typeoverlaps 306-584
561-583PF00096Zinc finger, C2H2 typeoverlaps 306-584
589-611PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions