ModCRE DB

Transcription factor

Q53HT3

Heat shock transcription factor 1 variant

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 529 aa

11 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2
MotifPredictionSourceDNA bindingSupportLogoActions
MA0486.1 NN 70+% JASPAR CTTCTAGAAGGTTCT 99.4% identity Open · Scan
M03330_2.00 NN 70+% CisBP GAACGTTCTAGAA 97.4% identity Open · Scan
Nearest Neighbor (70% - 40%)9
MotifPredictionSourceDNA bindingSupportLogoActions
M02248_2.00 NN 70-40% CisBP GAATGTTCTATAT 62.6% identity Open · Scan
M05506_2.00 NN 70-40% CisBP GGAACGTTCTAGAAC 59.9% identity Open · Scan
MA0770.1 NN 70-40% JASPAR TTCTAGAACGTTC 59.9% identity Open · Scan
M01257_2.00 NN 70-40% CisBP AATCTTCCAT 58.9% identity Open · Scan
MA0771.1 NN 70-40% JASPAR TTCTAGAACGTTC 57.7% identity Open · Scan
M06388_2.00 NN 70-40% CisBP TCGAAACTTCTAGA 54.9% identity Open · Scan
M06942_2.00 NN 70-40% CisBP AGAAGCTTCTAGAAG 50.9% identity Open · Scan
M06946_2.00 NN 70-40% CisBP AGAAGCTTCTAGAA 50.9% identity Open · Scan
M08586_2.00 NN 70-40% CisBP TTTTATTTCTTCTATTCTCTA 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 529 aa
13-120

Region 13-120 0 PWM

Residues
108 aa
Domains
PF00447 · HSF-type DNA-binding
3D models
1 active PDB
Templates
5D5V
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 13-1201 model
Actions
Predicted = Low TFS_Q53HT3:13:120_5d5v_D_1 5d5v 13-120 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
18-118PF00447HSF-type DNA-bindingoverlaps 13-120
247-529PF06546Vertebrate heat shock transcription factorNo overlap with loaded model regions