ModCRE DB

Transcription factor

Q53TD0 - SP100

UniProtKB entry deleted

6 Generated PWM 5 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M00191_2.00 NN 70-40% CisBP TTTTTCGTAA 52.6% identity Open · Scan
ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_Q53TD0_Q53TD0_HUMAN:663:795_5zdz_N_1 ModCRE Homology model TCATAAAATCCCCGGACGCCGGCCCGGCTCCGG Region 663-795 · 1 3D model Open · Scan
TFS_tr_Q53TD0_Q53TD0_HUMAN:663:795_5ze0_N_1 ModCRE Homology model ACATAAAATCCCCAGGGAGCGGCCCGCGGGCTAACA Region 663-795 · 1 3D model Open · Scan
TFS_tr_Q53TD0_Q53TD0_HUMAN:663:795_5ze1_N_1 ModCRE Homology model ATAAAAAATTCCCGGCCGCCGGCGCGCCACACTCGA Region 663-795 · 1 3D model Open · Scan
TFS_tr_Q53TD0_Q53TD0_HUMAN:663:795_5ze2_N_1 ModCRE Homology model TAGCAAATCCCCCGCTACCGCGCGGCGGCCTAACA Region 663-795 · 1 3D model Open · Scan
TFS_tr_Q53TD0_Q53TD0_HUMAN:663:796_6cij_N_1 ModCRE Homology model TACAATATTTACATTTGCGCCGCCGGTT Region 663-796 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

Region 663-796 5 PWM

Residues
134 aa
Domains
No overlapping PFAM annotation recorded
3D models
5 active PDBs · 5 summary rows
Templates
5ZDZ, 5ZE0, 5ZE1, 5ZE2, 6CIJ
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
5 active PDB models 5 summary rows
Region 663-7965 models · 5 summary rows
Actions
Predicted = Low TFS_tr_Q53TD0_Q53TD0_HUMAN:663:795_5zdz_N_1 5zdz 663-795 View model · PDB
Predicted = Low TFS_tr_Q53TD0_Q53TD0_HUMAN:663:795_5ze0_N_1 5ze0 663-795 View model · PDB
Predicted = Low TFS_tr_Q53TD0_Q53TD0_HUMAN:663:795_5ze1_N_1 5ze1 663-795 View model · PDB
Predicted = Low TFS_tr_Q53TD0_Q53TD0_HUMAN:663:795_5ze2_N_1 5ze2 663-795 View model · PDB
Predicted = Low TFS_tr_Q53TD0_Q53TD0_HUMAN:663:796_6cij_N_1 6cij 663-796 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 6cij 663:807 663 796 P:N · DNA:G,M 78.4% / 79.9% 87 View · PDB TFS_tr_Q53TD0_Q53TD0_HUMAN:663:796_6cij_N_1
2 5ze2 663:807 663 795 P:N · DNA:G,M 67.7% / 69.2% 88 View · PDB TFS_tr_Q53TD0_Q53TD0_HUMAN:663:795_5ze2_N_1
3 5ze1 663:807 663 795 P:N · DNA:G,M 67.7% / 69.2% 88 View · PDB TFS_tr_Q53TD0_Q53TD0_HUMAN:663:795_5ze1_N_1
4 5zdz 663:807 663 795 P:N · DNA:G,M 67.7% / 69.2% 88 View · PDB TFS_tr_Q53TD0_Q53TD0_HUMAN:663:795_5zdz_N_1
5 5ze0 663:807 663 795 P:N · DNA:G,M 67.7% / 69.2% 87 View · PDB TFS_tr_Q53TD0_Q53TD0_HUMAN:663:795_5ze0_N_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Imported domain tags5
DUF1898DUF3195HMG_boxSANDSp100