ModCRE DB

Transcription factor

Q59EI7

Cytoplasmic nuclear factor of activated T-cells 3 isoform 4 variant

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 611 aa

8 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)3
MotifPredictionSourceDNA bindingSupportLogoActions
MA0625.1 NN 70+% JASPAR ATTTTCCATT 99.6% identity Open · Scan
M05693_2.00 NN 70+% CisBP ATTTTCCATT 99.1% identity Open · Scan
M02446_2.00 NN 70+% CisBP ATTTTCCATT 73.8% identity Open · Scan
Nearest Neighbor (70% - 40%)5
MotifPredictionSourceDNA bindingSupportLogoActions
MA0624.1 NN 70-40% JASPAR ATTTTCCATT 69.0% identity Open · Scan
M03449_2.00 NN 70-40% CisBP AGGGAAAATAATTTTCCATT 68.6% identity Open · Scan
M05703_2.00 NN 70-40% CisBP ATTTTCCGTT 64.7% identity Open · Scan
MA1525.1 NN 70-40% JASPAR AATGGAAAAT 64.6% identity Open · Scan
MA0152.1 NN 70-40% JASPAR TTTTCCA 63.5% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 611 aa
130-265

Region 130-265 0 PWM

Residues
136 aa
Domains
PF00554 · Rel homology DNA-binding domain PF16179 · Rel homology dimerisation domain
3D models
1 active PDB
Templates
1RAM
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 130-2651 model
Actions
Predicted = Low DIMER_Q59EI7:130:265_1ram_B_1 1ram 130-265 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
32-157PF00554Rel homology DNA-binding domainoverlaps 130-265
168-265PF16179Rel homology dimerisation domainoverlaps 130-265