ModCRE DB

Transcription factor

Q59F55

Zinc finger protein Gfi-1 variant

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 434 aa

15 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)6
MotifPredictionSourceDNA bindingSupportLogoActions
MA0038.2 NN 70+% JASPAR CAAATCACTGCA 99.5% identity Open · Scan
M04524_2.00 NN 70+% CisBP TAAATCACTGCATTTCACTCA 88.7% identity Open · Scan
MA0483.1 NN 70+% JASPAR AAATCACAGCA 88.7% identity Open · Scan
MA0038.1 NN 70+% JASPAR CAAATCACTG 87.2% identity Open · Scan
M00619_2.00 NN 70+% CisBP TAAATCACGG 76.8% identity Open · Scan
M08977_2.00 NN 70+% CisBP AAATCACAGC 74.2% identity Open · Scan
Nearest Neighbor (70% - 40%)9
MotifPredictionSourceDNA bindingSupportLogoActions
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 54.7% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 53.5% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 51.8% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 51.8% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 51.1% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 50.6% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 50.0% identity Open · Scan
M01456_2.00 NN 70-40% CisBP GTGATCGGCG 50.0% identity Open · Scan
M01529_2.00 NN 70-40% CisBP CCCCGCATT 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 434 aa
263-428

Region 263-428 0 PWM

Residues
166 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5V3J
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 263-4281 model
Actions
Predicted = Low TFS_Q59F55:263:428_5v3j_E_1 5v3j 263-428 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
267-290PF00096Zinc finger, C2H2 typeoverlaps 263-428
296-318PF00096Zinc finger, C2H2 typeoverlaps 263-428
324-346PF00096Zinc finger, C2H2 typeoverlaps 263-428
352-374PF00096Zinc finger, C2H2 typeoverlaps 263-428
380-402PF00096Zinc finger, C2H2 typeoverlaps 263-428
410-431PF00096Zinc finger, C2H2 typeoverlaps 263-428