ModCRE DB

Transcription factor

Q59FU3

Far upstream element-binding protein 1

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 493 aa

3 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE3
MotifPredictionSourceDNA bindingSupportLogoActions
q59fu3.af3.0 ModCRE AlphaFold3 model CCCTTGTGTCAATCTTCAAACCCC AlphaFold3 model · ModCRE PWM Open · Scan
q59fu3.af3.1 ModCRE AlphaFold3 model GGGGCCCGATAGTCAGT AlphaFold3 model · ModCRE PWM Open · Scan
q59fu3.af3.2 ModCRE AlphaFold3 model CCCTTGTGTCAATCTTCAAACCCC AlphaFold3 model · ModCRE PWM Open · Scan
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models
SourceModelTemplateResidues modeledActions
Predicted = Lowq59fu3.af3.0-Full sequenceView model · PDB
Predicted = Lowq59fu3.af3.1-Full sequenceView model · PDB
Predicted = Lowq59fu3.af3.2-Full sequenceView model · PDB
Predicted = Lowq59fu3.af3.3-Full sequenceView model · PDB
Predicted = Lowq59fu3.af3.4-Full sequenceView model · PDB
Predicted = Lowq59fu3.af3.5-Full sequenceView model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomain
38-103PF00013KH domain
130-190PF00013KH domain
230-295PF00013KH domain
426-445PF09005Far upstream element-binding protein, C-terminal
454-472PF09005Far upstream element-binding protein, C-terminal