ModCRE DB

Transcription factor

Q59GI1

Serum response factor

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 295 aa

8 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)4
MotifPredictionSourceDNA bindingSupportLogoActions
MA0083.1 NN 70+% JASPAR GCCCATATATGG 99.2% identity Open · Scan
M00178_2.00 NN 70+% CisBP CCAAATTTGG 94.2% identity Open · Scan
M00684_2.00 NN 70+% CisBP CATATAAGG 86.0% identity Open · Scan
M03915_2.00 NN 70+% CisBP ACCATATATGGT 84.0% identity Open · Scan
Nearest Neighbor (70% - 40%)4
MotifPredictionSourceDNA bindingSupportLogoActions
M08458_2.00 NN 70-40% CisBP TTCCTAATTGGG 67.9% identity Open · Scan
M06994_2.00 NN 70-40% CisBP TCACCA 55.2% identity Open · Scan
M08587_2.00 NN 70-40% CisBP TTACCTATAATTAAATTAGCA 54.0% identity Open · Scan
M08588_2.00 NN 70-40% CisBP CGGCCTAGTGCGGAAA 50.5% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 295 aa
147-231

Region 147-231 0 PWM

Residues
85 aa
Domains
PF00319 · SRF-type transcription factor (DNA-binding and dimerisation domain)
3D models
1 active PDB
Templates
1K6O
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 147-2311 model
Actions
Predicted = Low DIMER_Q59GI1:147:231_1k6o_B_1 1k6o 147-231 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
160-207PF00319SRF-type transcription factor (DNA-binding and dimerisation domain)overlaps 147-231