ModCRE DB

Transcription factor

Q59GY7

Signal transducer and activator of transcription

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 765 aa

3 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)3
MotifPredictionSourceDNA bindingSupportLogoActions
M11356_2.00 NN 70+% CisBP TTCCCAGAATTGCGTTTCCTAGAG 96.0% identity Open · Scan
MA0519.1 NN 70+% JASPAR ATTTCCAAGAA 92.4% identity Open · Scan
M09417_2.00 NN 70+% CisBP ATTTCTAAGAAA 89.9% identity Open · Scan
Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 765 aa
257-674

Region 257-674 0 PWM

Residues
418 aa
Domains
PF01017 · STAT transcription factor, coiled-coil domain PF02864 · STAT protein, DNA binding domain PF21354 · Signal transducer and activator of transcription, linker domain PF00017 · SH2 domain
3D models
1 active PDB
Templates
4Y5W
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 257-6741 model
Actions
Predicted = Low DIMER_Q59GY7:257:674_4y5w_A_1 4y5w 257-674 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
5-125PF02865STAT protein, protein interaction domainNo overlap with loaded model regions
148-326PF01017STAT transcription factor, coiled-coil domainoverlaps 257-674
338-462PF02864STAT protein, DNA binding domainoverlaps 257-674
463-545PF21354Signal transducer and activator of transcription, linker domainoverlaps 257-674
566-640PF00017SH2 domainoverlaps 257-674