Transcription factor

Q59HH1

BTB/POZ domain zinc finger transcription factor (Protein kinase A RI subunit alpha-associated protein) (Zinc finger and BTB domain-containing protein 19) (Zinc finger protein 278)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 651 aa

5 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M08864_2.00	NN 70+%	CisBP	CCTCCCCCCCCGCCCCCTCCCC	99.7% identity		Open · Scan

Nearest Neighbor (70% - 40%)4

Motif	Prediction	Source	DNA binding	Support	Actions
MA1578.1	NN 70-40%	JASPAR	CCCCCCACTT	65.7% identity	Open · Scan
M08870_2.00	NN 70-40%	CisBP	CCCCCCCCCCCCCCCCTCCCCC	61.4% identity	Open · Scan
M01531_2.00	NN 70-40%	CisBP	CCCCCCCTAAAT	55.3% identity	Open · Scan
MA1522.1	NN 70-40%	JASPAR	CGCCCCTCCCC	52.4% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 651 aa

363-474

Region 363-474 0 PWM

Residues: 112 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13912 · C2H2-type zinc finger
3D models: 1 active PDB
Templates: 5EGB
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 363-4741 model

				Actions
Predicted = Low	TFS_Q59HH1:363:474_5egb_A_1	5egb	363-474	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
40-169	PF00651	BTB/POZ domain	No overlap with loaded model regions
367-387	PF00096	Zinc finger, C2H2 type	overlaps 363-474
393-415	PF00096	Zinc finger, C2H2 type	overlaps 363-474
423-446	PF00096	Zinc finger, C2H2 type	overlaps 363-474
452-476	PF13912	C2H2-type zinc finger	overlaps 363-474
504-568	PF16637	Putative zinc-finger between two C2H2 zinc-fingers on Patz	No overlap with loaded model regions
569-592	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions