ModCRE DB

Transcription factor

Q59HH4

Zinc finger protein 76 (Expressed in testis) variant

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 222 aa

25 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2
MotifPredictionSourceDNA bindingSupportLogoActions
MA0088.1 NN 70+% JASPAR GATTTCCCATAATGCCTTGC 85.9% identity Open · Scan
MA0088.2 NN 70+% JASPAR TACCCACAATGCATTG 85.0% identity Open · Scan
Nearest Neighbor (70% - 40%)23
MotifPredictionSourceDNA bindingSupportLogoActions
M00950_2.00 NN 70-40% CisBP GCAGCCCA 56.6% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 55.5% identity Open · Scan
M01868_2.00 NN 70-40% CisBP TCTTGGCG 55.5% identity Open · Scan
M08908_2.00 NN 70-40% CisBP GCTGCTGCTTCTGCTG 55.5% identity Open · Scan
M04653_2.00 NN 70-40% CisBP GGTACGGTTGTCCATGTTGCAA 54.8% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 54.4% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 54.4% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 54.4% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 54.4% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 53.3% identity Open · Scan
M08373_2.00 NN 70-40% CisBP CCCCCTGGCTCTTCCTCT 53.0% identity Open · Scan
MA1516.1 NN 70-40% JASPAR GACCACGCCCA 52.9% identity Open · Scan
M08375_2.00 NN 70-40% CisBP TTCCCCATTGGCTACTGCACCGGTCCT 52.4% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 52.2% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 52.2% identity Open · Scan
MA0863.1 NN 70-40% JASPAR TTTGCACACGGCAC 52.0% identity Open · Scan
M04430_2.00 NN 70-40% CisBP GACCACGCCCA 51.4% identity Open · Scan
MA0599.1 NN 70-40% JASPAR GCCCCGCCCC 51.4% identity Open · Scan
MA1587.1 NN 70-40% JASPAR CCTCGACCTCCTGA 50.4% identity Open · Scan
M00779_2.00 NN 70-40% CisBP GCCACGCCCA 50.0% identity Open · Scan
M04387_2.00 NN 70-40% CisBP CGTGCTCCCC 50.0% identity Open · Scan
M08540_2.00 NN 70-40% CisBP CCCCT 50.0% identity Open · Scan
M08867_2.00 NN 70-40% CisBP CACCCCCTG 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 222 aa
26-123

Region 26-123 0 PWM

Residues
98 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
1UBD
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 26-1231 model
Actions
Predicted = Low TFS_Q59HH4:26:123_1ubd_C_1 1ubd 26-123 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
39-63PF00096Zinc finger, C2H2 typeoverlaps 26-123
69-93PF00096Zinc finger, C2H2 typeoverlaps 26-123
99-123PF00096Zinc finger, C2H2 typeoverlaps 26-123