ModCRE DB

Transcription factor

Q5CZI3 - DKFZp686C13142

Uncharacterized protein DKFZp686C13142

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 665 aa

34 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M07607_2.00 NN 70+% CisBP GGCTCCACG 99.3% identity Open · Scan
Nearest Neighbor (70% - 40%)33
MotifPredictionSourceDNA bindingSupportLogoActions
M00939_2.00 NN 70-40% CisBP CCACCTCA 63.0% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 59.5% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 58.8% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 58.3% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 58.3% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 57.4% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 57.1% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 57.1% identity Open · Scan
M08985_2.00 NN 70-40% CisBP TGAGGACCTACTGTGTGCC 57.0% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 56.8% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 55.9% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 55.9% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 55.2% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 54.8% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 54.7% identity Open · Scan
M04598_2.00 NN 70-40% CisBP CGCTAACTCTCCACA 54.7% identity Open · Scan
MA1124.1 NN 70-40% JASPAR CATTCATTCATTC 54.1% identity Open · Scan
M08325_2.00 NN 70-40% CisBP TTTTTTTTT 53.4% identity Open · Scan
M04387_2.00 NN 70-40% CisBP CGTGCTCCCC 53.1% identity Open · Scan
MA1602.1 NN 70-40% JASPAR CGTCTACACGGG 52.2% identity Open · Scan
M08334_2.00 NN 70-40% CisBP TTTGTTTTTTTCTGATTGCTTTTTACTTAT 52.0% identity Open · Scan
M07638_2.00 NN 70-40% CisBP TGCAGCTCCCTGCCC 51.6% identity Open · Scan
M08908_2.00 NN 70-40% CisBP GCTGCTGCTTCTGCTG 51.2% identity Open · Scan
M00945_2.00 NN 70-40% CisBP CACCGCAC 51.1% identity Open · Scan
M08245_2.00 NN 70-40% CisBP TGGTGCCTTATTCCC 51.1% identity Open · Scan
M00782_2.00 NN 70-40% CisBP AGTGTGCGCTA 50.6% identity Open · Scan
M04590_2.00 NN 70-40% CisBP TGCGCTAACCATTGC 50.6% identity Open · Scan
M08355_2.00 NN 70-40% CisBP GCGAACTCCTATTCATCC 50.6% identity Open · Scan
MA1651.1 NN 70-40% JASPAR GTTCCAAAATGGCTGCCTCCG 50.6% identity Open · Scan
M00774_2.00 NN 70-40% CisBP TTAGTATACACAAGT 50.5% identity Open · Scan
M00786_2.00 NN 70-40% CisBP TATATATAT 50.2% identity Open · Scan
M01441_2.00 NN 70-40% CisBP CCCCTGAATT 50.0% identity Open · Scan
M08395_2.00 NN 70-40% CisBP GCTGCCTACTCTTCC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 665 aa
363-640

Region 363-640 0 PWM

Residues
278 aa
Domains
PF00096 · Zinc finger, C2H2 type PF13465 · Zinc-finger double domain PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5WJQ
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 363-6401 model
Actions
Predicted = Low TFS_Q5CZI3:363:640_5wjq_D_1 5wjq 363-640 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
3-42PF01352KRAB boxNo overlap with loaded model regions
202-242PF01352KRAB boxNo overlap with loaded model regions
366-388PF00096Zinc finger, C2H2 typeoverlaps 363-640
408-433PF13465Zinc-finger double domainoverlaps 363-640
450-472PF00096Zinc finger, C2H2 typeoverlaps 363-640
478-500PF00096Zinc finger, C2H2 typeoverlaps 363-640
506-528PF00096Zinc finger, C2H2 typeoverlaps 363-640
538-556PF00096Zinc finger, C2H2 typeoverlaps 363-640
562-584PF00096Zinc finger, C2H2 typeoverlaps 363-640
590-612PF00096Zinc finger, C2H2 typeoverlaps 363-640
618-640PF00096Zinc finger, C2H2 typeoverlaps 363-640