Transcription factor

Q5FBX3 - IRF1

Interferon regulatory factor 1

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 250 aa

3 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)3

Motif	Prediction	Source	DNA binding	Support	Actions
MA0050.1	NN 70+%	JASPAR	GAAAGCGAAACC	99.5% identity	Open · Scan
M09245_2.00	NN 70+%	CisBP	GAAAGTGAAAGTGAAAGTAA	76.1% identity	Open · Scan
MA0051.1	NN 70+%	JASPAR	GGAAAGCGAAACCAAAAC	76.1% identity	Open · Scan

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 250 aa

7-100

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 7-1001 model

				Actions
Predicted = Low	DIMER_Q5FBX3:7:100_1t2k_A_1	1t2k	7-100	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
7-112	PF00605	Interferon regulatory factor transcription factor	overlaps 7-100