ModCRE DB

Transcription factor

Q5JVG2 - ZNF484

Zinc finger protein 484

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 852 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07581_2.00 Known CisBP TCCCCTGTGCTTCTCTCCCCT Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 852 aa
439-715

Region 439-715 0 PWM

Residues
277 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5V3J
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 439-7151 model
Actions
Predicted = Low TFS_Q5JVG2:439:715_5v3j_E_1 5v3j 439-715 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
7-48PF01352KRAB boxNo overlap with loaded model regions
384-406PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
412-434PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
440-462PF00096Zinc finger, C2H2 typeoverlaps 439-715
468-490PF00096Zinc finger, C2H2 typeoverlaps 439-715
496-518PF00096Zinc finger, C2H2 typeoverlaps 439-715
552-574PF00096Zinc finger, C2H2 typeoverlaps 439-715
580-602PF00096Zinc finger, C2H2 typeoverlaps 439-715
608-630PF00096Zinc finger, C2H2 typeoverlaps 439-715
636-658PF00096Zinc finger, C2H2 typeoverlaps 439-715
664-686PF00096Zinc finger, C2H2 typeoverlaps 439-715
692-714PF00096Zinc finger, C2H2 typeoverlaps 439-715
720-742PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
748-770PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
776-798PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions