ModCRE DB

Transcription factor

Q5TGY3 - AHDC1

Transcription factor Gibbin (AT-hook DNA-binding motif-containing protein 1)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 1603 aa

6 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
q5tgy3.af3.0 ModCRE AlphaFold3 model AAAAAAAAAAACGACGGAAGGCCC AlphaFold3 model · ModCRE PWM Open · Scan
q5tgy3.af3.1 ModCRE AlphaFold3 model AAAAACCGGGGCCCGATCCCGCGGGACTCT AlphaFold3 model · ModCRE PWM Open · Scan
q5tgy3.af3.2 ModCRE AlphaFold3 model AAAAAAAAAAACGACGGAAGGCCC AlphaFold3 model · ModCRE PWM Open · Scan
q5tgy3.af3.3 ModCRE AlphaFold3 model TTTGCCAACCGGGGGGCCCCAAAGGGGACA AlphaFold3 model · ModCRE PWM Open · Scan
q5tgy3.af3.4 ModCRE AlphaFold3 model ACTTTAAAAAGTTGAATCCCGGAGCGCAAC AlphaFold3 model · ModCRE PWM Open · Scan
q5tgy3.af3.5 ModCRE AlphaFold3 model TTTCCCAACCTGGGTCAACCCATGTTG AlphaFold3 model · ModCRE PWM Open · Scan
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models
SourceModelTemplateResidues modeledActions
Predicted = Lowq5tgy3.af3.0-Full sequenceView model · PDB
Predicted = Lowq5tgy3.af3.1-Full sequenceView model · PDB
Predicted = Lowq5tgy3.af3.2-Full sequenceView model · PDB
Predicted = Lowq5tgy3.af3.3-Full sequenceView model · PDB
Predicted = Lowq5tgy3.af3.4-Full sequenceView model · PDB
Predicted = Lowq5tgy3.af3.5-Full sequenceView model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomain
584-641PF15735Domain of unknown function (DUF4683)