ModCRE DB

Transcription factor

Q63HK5 - TSHZ3

Teashirt homolog 3 (Zinc finger protein 537)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 1081 aa

7 Generated PWM 7 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE7
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_sp_Q63HK5_TSH3_HUMAN:1041:1068_1llm_C_1 ModCRE Homology model ATACCGCGGAAA Region 1041-1068 · 1 3D model Open · Scan
DIMER_sp_Q63HK5_TSH3_HUMAN:438:524_4ldx_B_1 ModCRE Homology model GGGGGCCCCGACGGGCCCCCC Region 438-524 · 1 3D model Open · Scan
TFS_sp_Q63HK5_TSH3_HUMAN:1041:1068_5vmz_A_1 ModCRE Homology model CAATTAAAAAG Region 1041-1068 · 1 3D model Open · Scan
TFS_sp_Q63HK5_TSH3_HUMAN:1041:1068_6df9_A_1 ModCRE Homology model CACCAGTTTCC Region 1041-1068 · 1 3D model Open · Scan
TFS_sp_Q63HK5_TSH3_HUMAN:207:407_5v3j_E_1 ModCRE Homology model AAGGGGCGCCCTCACCCCCGGC Region 207-407 · 1 3D model Open · Scan
TFS_sp_Q63HK5_TSH3_HUMAN:207:407_5v3m_C_1 ModCRE Homology model AGGGGGCCCCGGAGGCCCGGCC Region 207-407 · 1 3D model Open · Scan
TFS_sp_Q63HK5_TSH3_HUMAN:214:407_5wjq_D_1 ModCRE Homology model ACGAGGCACGTGTGCGCCGGGG Region 214-407 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1081 aa
207-407
438-524
1041-1068

Region 207-407 3 PWM

Residues
201 aa
Domains
PF13912 · C2H2-type zinc finger
3D models
3 active PDBs · 3 summary rows
Templates
5V3J, 5V3M, 5WJQ
Sources
Predicted = Low
Scan this region Show models

Region 438-524 1 PWM

Residues
87 aa
Domains
No overlapping PFAM annotation recorded
3D models
1 active PDB
Templates
4LDX
Sources
Predicted = Low
Scan this region Show models

Region 1041-1068 3 PWM

Residues
28 aa
Domains
No overlapping PFAM annotation recorded
3D models
3 active PDBs · 3 summary rows
Templates
1LLM, 5VMZ, 6DF9
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
7 active PDB models 6 summary rows
Region 207-4073 models · 3 summary rows
Actions
Predicted = Low TFS_sp_Q63HK5_TSH3_HUMAN:207:407_5v3j_E_1 5v3j 207-407 View model · PDB
Predicted = Low TFS_sp_Q63HK5_TSH3_HUMAN:207:407_5v3m_C_1 5v3m 207-407 View model · PDB
Predicted = Low TFS_sp_Q63HK5_TSH3_HUMAN:214:407_5wjq_D_1 5wjq 214-407 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
3 5wjq 207:407 214 407 P:D · DNA:A,B 20.0% / 37.4% 67 View · PDB TFS_sp_Q63HK5_TSH3_HUMAN:214:407_5wjq_D_1
1 5v3m 207:407 207 407 P:C · DNA:A,B 19.8% / 37.1% 70 View · PDB TFS_sp_Q63HK5_TSH3_HUMAN:207:407_5v3m_C_1
2 5v3j 207:407 207 407 P:E · DNA:A,B 19.8% / 37.1% 70 View · PDB TFS_sp_Q63HK5_TSH3_HUMAN:207:407_5v3j_E_1
Region 438-5241 model
Actions
Predicted = Low DIMER_sp_Q63HK5_TSH3_HUMAN:438:524_4ldx_B_1 4ldx 438-524 View model · PDB
Region 1041-10683 models · 3 summary rows
Actions
Predicted = Low DIMER_sp_Q63HK5_TSH3_HUMAN:1041:1068_1llm_C_1 1llm 1041-1068 View model · PDB
Predicted = Low TFS_sp_Q63HK5_TSH3_HUMAN:1041:1068_5vmz_A_1 5vmz 1041-1068 View model · PDB
Predicted = Low TFS_sp_Q63HK5_TSH3_HUMAN:1041:1068_6df9_A_1 6df9 1041-1068 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1llm 627:666 1041,1041 1068,1068 P:C,D · DNA:A,B 28.6% / 53.6% 32,32 View · PDB DIMER_sp_Q63HK5_TSH3_HUMAN:1041:1068_1llm_C_1
4 6df9 207:407 1041 1068 P:A · DNA:D,E 28.6% / 50.0% 24 View · PDB TFS_sp_Q63HK5_TSH3_HUMAN:1041:1068_6df9_A_1
5 5vmz 207:407 1041 1068 P:A · DNA:D,E 28.6% / 50.0% 22 View · PDB TFS_sp_Q63HK5_TSH3_HUMAN:1041:1068_5vmz_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
276-300PF13912C2H2-type zinc fingeroverlaps 207-407
899-963PF26094Teashirt homolog 3-like, homeodomainNo overlap with loaded model regions