Transcription factor

Q658Y5 - DKFZp667I0324

Transcription factor COE3 (Early B-cell factor 3) (Olf-1/EBF-like 2)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 537 aa

5 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)5

Motif	Prediction	Source	DNA binding	Support	Actions
MA1637.1	NN 70+%	JASPAR	TTCCCAAGGGAAT	92.0% identity	Open · Scan
M10469_2.00	NN 70+%	CisBP	ACAAACTCCCTGGGGAATAGTG	84.8% identity	Open · Scan
M09044_2.00	NN 70+%	CisBP	GGTCCCTGGGGACTT	84.5% identity	Open · Scan
MA0154.1	NN 70+%	JASPAR	ACCCAAGGGA	83.7% identity	Open · Scan
MA1604.1	NN 70+%	JASPAR	TTCCCAAGGGACT	81.7% identity	Open · Scan

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 537 aa

21-226

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 21-2261 model

				Actions
Predicted = Low	TFS_Q658Y5:21:226_3mln_A_1	3mln	21-226	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
5-233	PF16422	Transcription factor COE1 DNA-binding domain	overlaps 21-226
240-322	PF01833	IPT/TIG domain	No overlap with loaded model regions
325-368	PF16423	Transcription factor COE1 helix-loop-helix domain	No overlap with loaded model regions