ModCRE DB

Transcription factor

Q658Y5 - DKFZp667I0324

Transcription factor COE3 (Early B-cell factor 3) (Olf-1/EBF-like 2)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 537 aa

5 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)5
MotifPredictionSourceDNA bindingSupportLogoActions
MA1637.1 NN 70+% JASPAR TTCCCAAGGGAAT 92.0% identity Open · Scan
M10469_2.00 NN 70+% CisBP ACAAACTCCCTGGGGAATAGTG 84.8% identity Open · Scan
M09044_2.00 NN 70+% CisBP GGTCCCTGGGGACTT 84.5% identity Open · Scan
MA0154.1 NN 70+% JASPAR ACCCAAGGGA 83.7% identity Open · Scan
MA1604.1 NN 70+% JASPAR TTCCCAAGGGACT 81.7% identity Open · Scan
Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 537 aa
21-226

Region 21-226 0 PWM

Residues
206 aa
Domains
PF16422 · Transcription factor COE1 DNA-binding domain
3D models
1 active PDB
Templates
3MLN
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 21-2261 model
Actions
Predicted = Low TFS_Q658Y5:21:226_3mln_A_1 3mln 21-226 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
5-233PF16422Transcription factor COE1 DNA-binding domainoverlaps 21-226
240-322PF01833IPT/TIG domainNo overlap with loaded model regions
325-368PF16423Transcription factor COE1 helix-loop-helix domainNo overlap with loaded model regions