ModCRE DB

Transcription factor

Q68CX9 - DKFZp686K03205

Uncharacterized protein DKFZp686K03205

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 569 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M08949_2.00 Known CisBP TTCTATTTCTTCTTGTGTCA Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 569 aa
149-310

Region 149-310 0 PWM

Residues
162 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5T0U
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 149-3101 model
Actions
Predicted = Low TFS_Q68CX9:149:310_5t0u_A_1 5t0u 149-310 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
121-143PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
149-169PF00096Zinc finger, C2H2 typeoverlaps 149-310
177-200PF00096Zinc finger, C2H2 typeoverlaps 149-310
206-228PF00096Zinc finger, C2H2 typeoverlaps 149-310
234-256PF00096Zinc finger, C2H2 typeoverlaps 149-310
262-284PF00096Zinc finger, C2H2 typeoverlaps 149-310
290-312PF00096Zinc finger, C2H2 typeoverlaps 149-310
318-340PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
346-368PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
374-396PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
402-424PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
430-452PF13912C2H2-type zinc fingerNo overlap with loaded model regions
458-480PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
486-508PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions