ModCRE DB

Transcription factor

Q68DI1 - ZNF776

Zinc finger protein 776

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 518 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07601_2.00 Known CisBP CAGATGCCGGCACCATGCTTC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 518 aa
233-511

Region 233-511 0 PWM

Residues
279 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5WJQ
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 233-5111 model
Actions
Predicted = Low TFS_Q68DI1:233:511_5wjq_D_1 5wjq 233-511 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
14-54PF01352KRAB boxNo overlap with loaded model regions
264-286PF00096Zinc finger, C2H2 typeoverlaps 233-511
292-314PF00096Zinc finger, C2H2 typeoverlaps 233-511
320-342PF00096Zinc finger, C2H2 typeoverlaps 233-511
348-370PF00096Zinc finger, C2H2 typeoverlaps 233-511
376-398PF00096Zinc finger, C2H2 typeoverlaps 233-511
404-426PF00096Zinc finger, C2H2 typeoverlaps 233-511
432-454PF00096Zinc finger, C2H2 typeoverlaps 233-511
460-482PF00096Zinc finger, C2H2 typeoverlaps 233-511
488-510PF00096Zinc finger, C2H2 typeoverlaps 233-511