ModCRE DB

Transcription factor

Q6AHZ7 - DKFZp686A111

Uncharacterized protein DKFZp686A111

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 2109 aa

2 Generated PWM 2 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE2
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_Q6AHZ7_Q6AHZ7_HUMAN:1:716_8cli_A_1 ModCRE Homology model GGGCATTGTTAGGGGCCCCTATTT Region 1-716 · 1 3D model Open · Scan
TFS_tr_Q6AHZ7_Q6AHZ7_HUMAN:1:716_8clj_A_1 ModCRE Homology model GAAAACCCTTAAGGCCCCCTAGGG Region 1-716 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 2109 aa
1-716

Region 1-716 2 PWM

Residues
716 aa
Domains
PF23704 · General transcription factor 3C polypeptide 1, winged-helix domain PF04182 · B-block binding subunit of TFIIIC PF24101 · GTF3C1, extended winged-helix domain
3D models
2 active PDBs · 2 summary rows
Templates
8CLI, 8CLJ
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
2 active PDB models 2 summary rows
Region 1-7162 models · 2 summary rows
Actions
Predicted = Low TFS_tr_Q6AHZ7_Q6AHZ7_HUMAN:1:716_8cli_A_1 8cli 1-716 View model · PDB
Predicted = Low TFS_tr_Q6AHZ7_Q6AHZ7_HUMAN:1:716_8clj_A_1 8clj 1-716 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 8clj 1:716 1 716 P:A · DNA:D,E 75.7% / 75.7% 100 View · PDB TFS_tr_Q6AHZ7_Q6AHZ7_HUMAN:1:716_8clj_A_1
2 8cli 1:716 1 716 P:A · DNA:D,E 75.7% / 75.7% 100 View · PDB TFS_tr_Q6AHZ7_Q6AHZ7_HUMAN:1:716_8cli_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
1-70PF23704General transcription factor 3C polypeptide 1, winged-helix domainoverlaps 1-716
174-249PF04182B-block binding subunit of TFIIICoverlaps 1-716
609-717PF24101GTF3C1, extended winged-helix domainoverlaps 1-716