Transcription factor

Q6B0D6 - ZNF285A

ZNF285A protein

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 446 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M07777_2.00	Known	CisBP	GCCAATTTCCGTGGTGTAAAT	Direct PWM		Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 446 aa

143-418

Residues: 276 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 1 active PDB
Templates: 5V3J
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 143-4181 model

				Actions
Predicted = Low	TFS_Q6B0D6:143:418_5v3j_E_1	5v3j	143-418	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
172-194	PF00096	Zinc finger, C2H2 type	overlaps 143-418
200-222	PF00096	Zinc finger, C2H2 type	overlaps 143-418
228-250	PF00096	Zinc finger, C2H2 type	overlaps 143-418
256-278	PF00096	Zinc finger, C2H2 type	overlaps 143-418
284-306	PF00096	Zinc finger, C2H2 type	overlaps 143-418
312-334	PF00096	Zinc finger, C2H2 type	overlaps 143-418
340-362	PF00096	Zinc finger, C2H2 type	overlaps 143-418
368-390	PF00096	Zinc finger, C2H2 type	overlaps 143-418
396-418	PF00096	Zinc finger, C2H2 type	overlaps 143-418