Transcription factor

Q6DD87 - ZNF787

Zinc finger protein 787 (TTF-I-interacting peptide 20)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 382 aa

4 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known4

Motif	Prediction	Source	DNA binding	Support	Actions
M04475_2.00	Known	CisBP	GATGCACGTACCGTGCCTCA	Direct PWM	Open · Scan
M04473_2.00	Known	CisBP	GATGCACCTACCGTGCCTCG	Direct PWM	Open · Scan
M04474_2.00	Known	CisBP	TGCCTCAGTTTACCC	Direct PWM	Open · Scan
M04476_2.00	Known	CisBP	TGCCTCAGTTTACCC	Direct PWM	Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 382 aa

65-172

Residues: 108 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13465 · Zinc-finger double domain
3D models: 1 active PDB
Templates: 6E94
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 65-1721 model

				Actions
Predicted = Low	TFS_Q6DD87:65:172_6e94_A_1	6e94	65-172	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
66-88	PF00096	Zinc finger, C2H2 type	overlaps 65-172
96-116	PF00096	Zinc finger, C2H2 type	overlaps 65-172
136-161	PF13465	Zinc-finger double domain	overlaps 65-172
178-200	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
316-339	PF13912	C2H2-type zinc finger	No overlap with loaded model regions