Transcription factor

Q6FI30 - NFIC

Nuclear factor 1

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 499 aa

8 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)4

Motif	Prediction	Source	DNA binding	Support	Actions
M05745_2.00	NN 70+%	CisBP	GTTGGCACGGTGCCAAC	99.7% identity	Open · Scan
MA0119.1	NN 70+%	JASPAR	TGGCACCATGCCAA	99.7% identity	Open · Scan
M03479_2.00	NN 70+%	CisBP	CTGGCACTGTGCCAA	87.0% identity	Open · Scan
M03481_2.00	NN 70+%	CisBP	GGTGCCAAGT	76.0% identity	Open · Scan

Nearest Neighbor (70% - 40%)4

Motif	Prediction	Source	DNA binding	Support	Actions
MA1643.1	NN 70-40%	JASPAR	TGCCTGGCATTGTGCCAAGCA	64.4% identity	Open · Scan
MA0670.1	NN 70-40%	JASPAR	GGTGCCAAGT	62.8% identity	Open · Scan
M05741_2.00	NN 70-40%	CisBP	GTTGGCACGGTGCCAGG	57.7% identity	Open · Scan
MA0671.1	NN 70-40%	JASPAR	CGTGCCAAG	56.9% identity	Open · Scan

ModCRE0

No generated PWM in this category.

AF3 model assignments

Validated exact-accession AF3 models stored in local staging. Confidence artifacts are indexed but not visualized yet.

1 active AF3 model

Type	Model	Residues / fragment	Interface	Confidence files	Actions
AF3 full-length model	Q6FI30_model.cif	Full sequence	PASS_NONEMPTY_PROTEIN_DNA_INTERFACE	3 indexed	View model · mmCIF

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain
2-38	PF10524	Nuclear factor I protein pre-N-terminus
61-161	PF03165	MH1 domain
208-494	PF00859	CTF/NF-I family transcription modulation region