ModCRE DB

Transcription factor

Q6GZ75 - NR1I3

Nuclear receptor subfamily 1 group I member 3 (Constitutive androstane receptor)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 263 aa

19 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
MA1534.1 NN 70+% JASPAR ATGAACTTT 86.0% identity Open · Scan
Nearest Neighbor (70% - 40%)18
MotifPredictionSourceDNA bindingSupportLogoActions
M03923_2.00 NN 70-40% CisBP AGAACACTGTGTACC 62.5% identity Open · Scan
M05886_2.00 NN 70-40% CisBP AGTACATTTTGTTCT 58.3% identity Open · Scan
M07987_2.00 NN 70-40% CisBP GCCCAGAACATTCTGTTCCCT 58.3% identity Open · Scan
MA0113.1 NN 70-40% JASPAR GGGAACATTATGTCCTAA 58.3% identity Open · Scan
MA0164.1 NN 70-40% JASPAR CAAGCTT 56.2% identity Open · Scan
M00371_2.00 NN 70-40% CisBP ACTTAATATATAC 55.1% identity Open · Scan
M00814_2.00 NN 70-40% CisBP AAAGTCAAAT 54.8% identity Open · Scan
M02409_2.00 NN 70-40% CisBP GAGATCAA 54.8% identity Open · Scan
M06432_2.00 NN 70-40% CisBP AAAAATCAAAGGT 54.8% identity Open · Scan
MA0676.1 NN 70-40% JASPAR AAAAGTCAA 54.8% identity Open · Scan
MA0007.2 NN 70-40% JASPAR AAGAACAGAATGTTC 54.1% identity Open · Scan
MA0007.3 NN 70-40% JASPAR GGGAACACGGTGTACCC 54.1% identity Open · Scan
MA1540.1 NN 70-40% JASPAR GTCAAGGTCAC 52.3% identity Open · Scan
M06431_2.00 NN 70-40% CisBP AAAAGTCAAA 51.6% identity Open · Scan
M00690_2.00 NN 70-40% CisBP AAAGATCAAA 50.0% identity Open · Scan
M03927_2.00 NN 70-40% CisBP GAAACTAGAGCA 50.0% identity Open · Scan
M03930_2.00 NN 70-40% CisBP AACTAGAGCAC 50.0% identity Open · Scan
M06417_2.00 NN 70-40% CisBP CAGTCCGAAGGTCACCGC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 263 aa
7-252

Region 7-252 0 PWM

Residues
246 aa
Domains
PF00105 · Double treble clef zinc finger, C4 type PF00104 · Ligand-binding domain of nuclear hormone receptor
3D models
1 active PDB
Templates
4IQR
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 7-2521 model
Actions
Predicted = Low DIMER_Q6GZ75:7:252_4iqr_B_1 4iqr 7-252 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
7-49PF00105Double treble clef zinc finger, C4 typeoverlaps 7-252
100-250PF00104Ligand-binding domain of nuclear hormone receptoroverlaps 7-252