Transcription factor

Q6PK05 - ZNF331

ZNF331 protein

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 308 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M08309_2.00	Known	CisBP	AAAAACCCCCCTGCAGAGCCCAGCCCT	Direct PWM		Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 308 aa

122-308

Residues: 187 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 1 active PDB
Templates: 5V3J
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 122-3081 model

				Actions
Predicted = Low	TFS_Q6PK05:122:308_5v3j_E_1	5v3j	122-308	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
5-46	PF01352	KRAB box	No overlap with loaded model regions
131-153	PF00096	Zinc finger, C2H2 type	overlaps 122-308
159-181	PF00096	Zinc finger, C2H2 type	overlaps 122-308
187-209	PF00096	Zinc finger, C2H2 type	overlaps 122-308
215-237	PF00096	Zinc finger, C2H2 type	overlaps 122-308
243-265	PF00096	Zinc finger, C2H2 type	overlaps 122-308
271-293	PF00096	Zinc finger, C2H2 type	overlaps 122-308