ModCRE DB

Transcription factor

Q6TZ08

Progesterone receptor

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 255 aa

12 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M09609_2.00 NN 70+% CisBP CCAGGAACAG 91.4% identity Open · Scan
Nearest Neighbor (70% - 40%)11
MotifPredictionSourceDNA bindingSupportLogoActions
MA0007.3 NN 70-40% JASPAR GGGAACACGGTGTACCC 60.2% identity Open · Scan
M05886_2.00 NN 70-40% CisBP AGTACATTTTGTTCT 60.1% identity Open · Scan
M07987_2.00 NN 70-40% CisBP GCCCAGAACATTCTGTTCCCT 59.7% identity Open · Scan
MA0113.1 NN 70-40% JASPAR GGGAACATTATGTCCTAA 59.7% identity Open · Scan
MA0007.1 NN 70-40% JASPAR ATAAGAACACCCTGTACCCGCC 59.4% identity Open · Scan
MA0007.2 NN 70-40% JASPAR AAGAACAGAATGTTC 58.9% identity Open · Scan
M03923_2.00 NN 70-40% CisBP AGAACACTGTGTACC 56.9% identity Open · Scan
MA0727.1 NN 70-40% JASPAR GGGAACACAATGTTCCC 56.4% identity Open · Scan
M03382_2.00 NN 70-40% CisBP GGGAACACAATGTTCCC 55.5% identity Open · Scan
M02409_2.00 NN 70-40% CisBP GAGATCAA 54.4% identity Open · Scan
M06432_2.00 NN 70-40% CisBP AAAAATCAAAGGT 52.9% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 255 aa
16-87

Region 16-87 0 PWM

Residues
72 aa
Domains
PF00105 · Double treble clef zinc finger, C4 type
3D models
1 active PDB
Templates
5CBX
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 16-871 model
Actions
Predicted = Low DIMER_Q6TZ08:16:87_5cbx_B_1 5cbx 16-87 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
19-86PF00105Double treble clef zinc finger, C4 typeoverlaps 16-87
168-243PF00104Ligand-binding domain of nuclear hormone receptorNo overlap with loaded model regions