ModCRE DB

Transcription factor

Q6ZN55 - ZNF574

Zinc finger protein 574

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 896 aa

4 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known4
MotifPredictionSourceDNA bindingSupportLogoActions
M08239_2.00 Known CisBP GGGCCGCTCTAGGCTGCCGG Direct PWM Open · Scan
MA1982.1 Known JASPAR GGGCTAGAGCGGCCC Direct PWM Open · Scan
MA1982.2 Known JASPAR GGCTAGAGCGGCCC Direct PWM Open · Scan
M08294_2.00 Known CisBP CTAGAGCGGCCC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 896 aa
475-626

Region 475-626 0 PWM

Residues
152 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13912 · C2H2-type zinc finger
3D models
1 active PDB
Templates
2I13
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 475-6261 model
Actions
Predicted = Low TFS_Q6ZN55:475:626_2i13_A_1 2i13 475-626 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
309-332PF12874Zinc-finger of C2H2 typeNo overlap with loaded model regions
336-358PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
495-517PF00096Zinc finger, C2H2 typeoverlaps 475-626
523-545PF00096Zinc finger, C2H2 typeoverlaps 475-626
551-573PF00096Zinc finger, C2H2 typeoverlaps 475-626
579-601PF13912C2H2-type zinc fingeroverlaps 475-626
739-760PF13912C2H2-type zinc fingerNo overlap with loaded model regions
766-788PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
822-844PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions