ModCRE DB

Transcription factor

Q6ZN79 - ZNF705A

Zinc finger protein 705A

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 300 aa

19 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M07763_2.00 NN 70+% CisBP AGAGGTTTCTT 94.6% identity Open · Scan
Nearest Neighbor (70% - 40%)18
MotifPredictionSourceDNA bindingSupportLogoActions
M00939_2.00 NN 70-40% CisBP CCACCTCA 58.8% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 57.6% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 55.4% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 55.2% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 55.2% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 54.2% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 54.2% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 54.1% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 54.1% identity Open · Scan
M08320_2.00 NN 70-40% CisBP TTCCCTGCC 54.0% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 53.0% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 52.9% identity Open · Scan
M10303_2.00 NN 70-40% CisBP TACTGGGAATACC 52.3% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 51.9% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 51.7% identity Open · Scan
M01883_2.00 NN 70-40% CisBP TGCCCCTGA 51.1% identity Open · Scan
M04613_2.00 NN 70-40% CisBP CTCATGTGCTAATTACAAA 50.8% identity Open · Scan
M08917_2.00 NN 70-40% CisBP GCTGAGCCATGTGGGGTGCT 50.2% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 300 aa
113-299

Region 113-299 0 PWM

Residues
187 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5V3J
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 113-2991 model
Actions
Predicted = Low TFS_Q6ZN79:113:299_5v3j_E_1 5v3j 113-299 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
7-47PF01352KRAB boxNo overlap with loaded model regions
172-194PF00096Zinc finger, C2H2 typeoverlaps 113-299
200-222PF00096Zinc finger, C2H2 typeoverlaps 113-299
228-250PF00096Zinc finger, C2H2 typeoverlaps 113-299