ModCRE DB

Transcription factor

Q6ZN79 - ZNF705A

Zinc finger protein 705A

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 300 aa

19 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M07763_2.00 NN 70+% CisBP AGAGGTTTCTT 94.6% identity Open · Scan
Nearest Neighbor (70% - 40%)18
MotifPredictionSourceDNA bindingSupportLogoActions
M00939_2.00 NN 70-40% CisBP CCACCTCA 58.8% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 57.6% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 55.4% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 55.2% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 55.2% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 54.2% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 54.2% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 54.1% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 54.1% identity Open · Scan
M08320_2.00 NN 70-40% CisBP TTCCCTGCC 54.0% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 53.0% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 52.9% identity Open · Scan
M10303_2.00 NN 70-40% CisBP TACTGGGAATACC 52.3% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 51.9% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 51.7% identity Open · Scan
M01883_2.00 NN 70-40% CisBP TGCCCCTGA 51.1% identity Open · Scan
M04613_2.00 NN 70-40% CisBP CTCATGTGCTAATTACAAA 50.8% identity Open · Scan
M08917_2.00 NN 70-40% CisBP GCTGAGCCATGTGGGGTGCT 50.2% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 300 aa
113-299

Region 113-299 0 PWM

Residues
187 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5V3J
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 113-2991 model
Actions
Predicted = Low TFS_Q6ZN79:113:299_5v3j_E_1 5v3j 113-299 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
7-47PF01352KRAB boxNo overlap with loaded model regions
172-194PF00096Zinc finger, C2H2 typeoverlaps 113-299
200-222PF00096Zinc finger, C2H2 typeoverlaps 113-299
228-250PF00096Zinc finger, C2H2 typeoverlaps 113-299