ModCRE DB

Transcription factor

Q6ZP55 - DKFZp686G16228

cDNA FLJ26482 fis, clone KDN05127

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 397 aa

1 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07667_2.00 Known CisBP CCGCACAGGCCCCCGGGCCCC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 397 aa
76-378

Region 76-378 0 PWM

Residues
303 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs
Templates
1LLM, 2I13, 5V3J, 5V3M, 5WJQ, 7W1M
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models
Region 76-3786 models
Actions
Predicted = Low DIMER_Q6ZP55:131:182_1llm_D_1 1llm 131-182 View model · PDB
Predicted = Low TFS_Q6ZP55:102:378_5wjq_D_1 5wjq 102-378 View model · PDB
Predicted = Low TFS_Q6ZP55:105:377_7w1m_H_1 7w1m 105-377 View model · PDB
Predicted = Low TFS_Q6ZP55:142:295_2i13_A_1 2i13 142-295 View model · PDB
Predicted = Low TFS_Q6ZP55:76:352_5v3j_E_1 5v3j 76-352 View model · PDB
Predicted = Low TFS_Q6ZP55:76:352_5v3m_C_1 5v3m 76-352 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
49-71PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
77-99PF00096Zinc finger, C2H2 typeoverlaps 76-378
105-127PF00096Zinc finger, C2H2 typeoverlaps 76-378
133-155PF00096Zinc finger, C2H2 typeoverlaps 76-378
161-183PF00096Zinc finger, C2H2 typeoverlaps 76-378
189-211PF00096Zinc finger, C2H2 typeoverlaps 76-378
217-239PF00096Zinc finger, C2H2 typeoverlaps 76-378
245-267PF00096Zinc finger, C2H2 typeoverlaps 76-378
273-295PF00096Zinc finger, C2H2 typeoverlaps 76-378
301-323PF00096Zinc finger, C2H2 typeoverlaps 76-378
329-351PF00096Zinc finger, C2H2 typeoverlaps 76-378
357-377PF00096Zinc finger, C2H2 typeoverlaps 76-378