ModCRE DB

Transcription factor

Q6ZS47

cDNA FLJ45839 fis, clone NTONG2003805, highly similar to Zinc finger protein 45

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 538 aa

53 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M07579_2.00 NN 70+% CisBP CATCTCCAGGA 98.8% identity Open · Scan
Nearest Neighbor (70% - 40%)52
MotifPredictionSourceDNA bindingSupportLogoActions
M00953_2.00 NN 70-40% CisBP ATCTATAT 69.4% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 68.2% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 67.0% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 67.0% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 67.0% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 67.0% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 65.8% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 65.8% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 64.7% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 64.7% identity Open · Scan
MA1124.1 NN 70-40% JASPAR CATTCATTCATTC 61.4% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 61.2% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 61.1% identity Open · Scan
M08325_2.00 NN 70-40% CisBP TTTTTTTTT 60.8% identity Open · Scan
M08314_2.00 NN 70-40% CisBP ATTCATCAAGGTCCTCAACAATGG 58.8% identity Open · Scan
M04387_2.00 NN 70-40% CisBP CGTGCTCCCC 57.5% identity Open · Scan
M08295_2.00 NN 70-40% CisBP CTGCTGGAATCTCCA 57.4% identity Open · Scan
M04475_2.00 NN 70-40% CisBP GATGCACGTACCGTGCCTCA 56.2% identity Open · Scan
M08901_2.00 NN 70-40% CisBP CCAGTTCACACC 55.7% identity Open · Scan
M04598_2.00 NN 70-40% CisBP CGCTAACTCTCCACA 54.7% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 54.5% identity Open · Scan
M00149_2.00 NN 70-40% CisBP CGTACGCC 54.2% identity Open · Scan
M08985_2.00 NN 70-40% CisBP TGAGGACCTACTGTGTGCC 54.1% identity Open · Scan
M04465_2.00 NN 70-40% CisBP GTGATTCTTATCTTATCCTT 53.5% identity Open · Scan
M07683_2.00 NN 70-40% CisBP GTGGGAAAGCCT 53.3% identity Open · Scan
MA1601.1 NN 70-40% JASPAR ATGTGGGAAA 53.3% identity Open · Scan
M04505_2.00 NN 70-40% CisBP AGCTTTTCCCACAC 53.1% identity Open · Scan
M07610_2.00 NN 70-40% CisBP CCTTCTTCCTCCCCCCTGCCCACC 53.0% identity Open · Scan
MA1602.1 NN 70-40% JASPAR CGTCTACACGGG 53.0% identity Open · Scan
M00945_2.00 NN 70-40% CisBP CACCGCAC 52.8% identity Open · Scan
M07657_2.00 NN 70-40% CisBP CCCCTGCATGTCCCCATTTTT 52.4% identity Open · Scan
M04650_2.00 NN 70-40% CisBP GCATAACTGCCCCGCTGCC 52.3% identity Open · Scan
M07761_2.00 NN 70-40% CisBP CTGATTATTCACCCA 52.1% identity Open · Scan
M00782_2.00 NN 70-40% CisBP AGTGTGCGCTA 52.0% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 52.0% identity Open · Scan
M08355_2.00 NN 70-40% CisBP GCGAACTCCTATTCATCC 52.0% identity Open · Scan
M08267_2.00 NN 70-40% CisBP CAGTTTCATTTTCC 51.5% identity Open · Scan
M08399_2.00 NN 70-40% CisBP TACTCTGGGGCCACATGACTC 51.4% identity Open · Scan
M07590_2.00 NN 70-40% CisBP TTTTTTTCTTTTATTTTTTTTTTTTTTTTTTTT 51.2% identity Open · Scan
M08255_2.00 NN 70-40% CisBP CTCTTCCGGT 51.2% identity Open · Scan
M07660_2.00 NN 70-40% CisBP CCGCGCCTACCTGAGGGCGCGGGCCTGGGG 51.1% identity Open · Scan
M08263_2.00 NN 70-40% CisBP ATCTCGGCACTTTGGGAGGCCA 51.1% identity Open · Scan
M01456_2.00 NN 70-40% CisBP GTGATCGGCG 50.9% identity Open · Scan
M07578_2.00 NN 70-40% CisBP CAACTCTCC 50.9% identity Open · Scan
M08375_2.00 NN 70-40% CisBP TTCCCCATTGGCTACTGCACCGGTCCT 50.9% identity Open · Scan
M07723_2.00 NN 70-40% CisBP CCGCTGCTCCCTGCT 50.8% identity Open · Scan
M08245_2.00 NN 70-40% CisBP TGGTGCCTTATTCCC 50.3% identity Open · Scan
M08392_2.00 NN 70-40% CisBP CTTCACCTGCTGAGG 50.3% identity Open · Scan
M08949_2.00 NN 70-40% CisBP TTCTATTTCTTCTTGTGTCA 50.3% identity Open · Scan
M07638_2.00 NN 70-40% CisBP TGCAGCTCCCTGCCC 50.1% identity Open · Scan
M07598_2.00 NN 70-40% CisBP CTGACAATACCAAGTGTTGAC 50.0% identity Open · Scan
MA1154.1 NN 70-40% JASPAR CTTTCCCACAACACGAC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 538 aa
155-411

Region 155-411 0 PWM

Residues
257 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5WJQ
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 155-4111 model
Actions
Predicted = Low TFS_Q6ZS47:155:411_5wjq_D_1 5wjq 155-411 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
8-48PF01352KRAB boxNo overlap with loaded model regions
192-214PF00096Zinc finger, C2H2 typeoverlaps 155-411
276-298PF00096Zinc finger, C2H2 typeoverlaps 155-411
304-326PF00096Zinc finger, C2H2 typeoverlaps 155-411
332-354PF00096Zinc finger, C2H2 typeoverlaps 155-411
360-382PF00096Zinc finger, C2H2 typeoverlaps 155-411
388-410PF00096Zinc finger, C2H2 typeoverlaps 155-411
416-438PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions