ModCRE DB

Transcription factor

Q6ZUQ0

cDNA FLJ43466 fis, clone OCBBF2036743, weakly similar to ZINC FINGER PROTEIN 133

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 639 aa

19 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M07583_2.00 NN 70+% CisBP GAATTTATCACCACT 85.0% identity Open · Scan
Nearest Neighbor (70% - 40%)18
MotifPredictionSourceDNA bindingSupportLogoActions
M00952_2.00 NN 70-40% CisBP GGATGCTC 63.5% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 61.1% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 60.0% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 60.0% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 58.8% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 58.8% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 58.8% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 57.6% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 56.4% identity Open · Scan
M07610_2.00 NN 70-40% CisBP CCTTCTTCCTCCCCCCTGCCCACC 53.4% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 52.9% identity Open · Scan
M10303_2.00 NN 70-40% CisBP TACTGGGAATACC 52.9% identity Open · Scan
M07683_2.00 NN 70-40% CisBP GTGGGAAAGCCT 51.0% identity Open · Scan
MA1601.1 NN 70-40% JASPAR ATGTGGGAAA 51.0% identity Open · Scan
MA1124.1 NN 70-40% JASPAR CATTCATTCATTC 50.8% identity Open · Scan
M04598_2.00 NN 70-40% CisBP CGCTAACTCTCCACA 50.4% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 50.0% identity Open · Scan
M06112_2.00 NN 70-40% CisBP CTACTTTCACCGGGG 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 639 aa
205-483

Region 205-483 0 PWM

Residues
279 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5WJQ
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 205-4831 model
Actions
Predicted = Low TFS_Q6ZUQ0:205:483_5wjq_D_1 5wjq 205-483 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
12-52PF01352KRAB boxNo overlap with loaded model regions
208-230PF00096Zinc finger, C2H2 typeoverlaps 205-483
236-258PF00096Zinc finger, C2H2 typeoverlaps 205-483
264-286PF00096Zinc finger, C2H2 typeoverlaps 205-483
292-314PF00096Zinc finger, C2H2 typeoverlaps 205-483
320-342PF00096Zinc finger, C2H2 typeoverlaps 205-483
348-370PF00096Zinc finger, C2H2 typeoverlaps 205-483
376-398PF00096Zinc finger, C2H2 typeoverlaps 205-483
404-426PF00096Zinc finger, C2H2 typeoverlaps 205-483
432-454PF00096Zinc finger, C2H2 typeoverlaps 205-483
460-482PF00096Zinc finger, C2H2 typeoverlaps 205-483
490-510PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
516-538PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
573-595PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
601-623PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions