Transcription factor

Q71A33 - MAF

Transcription factor Maf

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 370 aa

9 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M08807_2.00	NN 70+%	CisBP	TTGCTGAGTCAGCAGATTC	95.4% identity		Open · Scan
MA0501.1	NN 70+%	JASPAR	ATGACTCAGCAATTT	95.4% identity		Open · Scan

Nearest Neighbor (70% - 40%)7

Motif	Prediction	Source	DNA binding	Support	Actions
M08835_2.00	NN 70-40%	CisBP	AAAATTGCTGACTCAGCA	61.1% identity	Open · Scan
MA0089.1	NN 70-40%	JASPAR	CATGAC	61.1% identity	Open · Scan
MA0496.1	NN 70-40%	JASPAR	CTGAGTCAGCAATTT	60.0% identity	Open · Scan
MA0591.1	NN 70-40%	JASPAR	AGGATGACTCAGCAC	60.0% identity	Open · Scan
MA0659.1	NN 70-40%	JASPAR	AAATTGCTGAGTCAGCATATT	60.0% identity	Open · Scan
MA0495.1	NN 70-40%	JASPAR	GCTGAGTCAGCAATTTTT	57.7% identity	Open · Scan
M08811_2.00	NN 70-40%	CisBP	CTGAGTCAGCA	50.5% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 370 aa

257-348

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 257-3481 model

				Actions
Predicted = Low	DIMER_Q71A33:257:348_4eot_A_1	4eot	257-348	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
86-119	PF08383	Maf N-terminal region	No overlap with loaded model regions
258-348	PF03131	bZIP Maf transcription factor	overlaps 257-348