ModCRE DB

Transcription factor

Q71MF7 - FP972

Uncharacterized protein FP972

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 545 aa

8 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M08239_2.00 NN 70+% CisBP GGGCCGCTCTAGGCTGCCGG 99.7% identity Open · Scan
Nearest Neighbor (70% - 40%)7
MotifPredictionSourceDNA bindingSupportLogoActions
M04409_2.00 NN 70-40% CisBP GGCGGCCATTTTGG 57.1% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 51.2% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 51.2% identity Open · Scan
M00609_2.00 NN 70-40% CisBP GGAAGCCCTA 50.5% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 50.5% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 50.0% identity Open · Scan
M06179_2.00 NN 70-40% CisBP TAAGCCTATAGA 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 545 aa
100-210

Region 100-210 0 PWM

Residues
111 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13912 · C2H2-type zinc finger
3D models
1 active PDB
Templates
5EGB
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 100-2101 model
Actions
Predicted = Low TFS_Q71MF7:100:210_5egb_A_1 5egb 100-210 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
103-125PF00096Zinc finger, C2H2 typeoverlaps 100-210
131-153PF00096Zinc finger, C2H2 typeoverlaps 100-210
159-181PF00096Zinc finger, C2H2 typeoverlaps 100-210
187-209PF13912C2H2-type zinc fingeroverlaps 100-210
347-368PF13912C2H2-type zinc fingerNo overlap with loaded model regions
374-390PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions