Transcription factor

Q86TJ5 - ZNF554

Zinc finger protein 554

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 538 aa

3 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known3

Motif	Prediction	Source	DNA binding	Support	Actions
M08917_2.00	Known	CisBP	GCTGAGCCATGTGGGGTGCT	Direct PWM	Open · Scan
M08341_2.00	Known	CisBP	CAGAGCCAGGTGGGGTGCTGG	Direct PWM	Open · Scan
ZN554_HUMAN.H11MO.0.C	Known	HOCOMOCO	GCTGAGCCATGTGGGGTGCT	Direct PWM	Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 538 aa

256-515

Residues: 260 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13465 · Zinc-finger double domain
3D models: 1 active PDB
Templates: 5WJQ
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 256-5151 model

				Actions
Predicted = Low	TFS_Q86TJ5:256:515_5wjq_D_1	5wjq	256-515	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
44-84	PF01352	KRAB box	No overlap with loaded model regions
324-346	PF00096	Zinc finger, C2H2 type	overlaps 256-515
352-374	PF00096	Zinc finger, C2H2 type	overlaps 256-515
382-402	PF00096	Zinc finger, C2H2 type	overlaps 256-515
408-430	PF00096	Zinc finger, C2H2 type	overlaps 256-515
436-458	PF00096	Zinc finger, C2H2 type	overlaps 256-515
478-503	PF13465	Zinc-finger double domain	overlaps 256-515