Region 668-692 3 PWM
- Residues
- 25 aa
- Domains
- PF26743 · CASZ1-like, zinc finger
- 3D models
- 3 active PDBs · 3 summary rows
- Templates
- 2WBS, 5KE7, 6VTX
- Sources
- Predicted = Low
Transcription factor
Q86V15 - CASZ1
Zinc finger protein castor homolog 1 (Castor-related protein) (Putative survival-related protein) (Zinc finger protein 693)
Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 1759 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known0
No generated PWM in this category.
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M08934_2.00 | NN 70-40% | CisBP | GCTGTACCTGCTTATTAGGC | 55.5% identity | Open · Scan |
ModCRE5
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| TFS_sp_Q86V15_CASZ1_HUMAN:1454:1486_5yj3_C_1 | ModCRE | Homology model | GGCCA | Region 1454-1486 · 1 3D model | Open · Scan | |
| TFS_sp_Q86V15_CASZ1_HUMAN:1454:1486_5yj3_D_1 | ModCRE | Homology model | AGGCCCAGAGCC | Region 1454-1486 · 1 3D model | Open · Scan | |
| TFS_sp_Q86V15_CASZ1_HUMAN:668:692_2wbs_A_1 | ModCRE | Homology model | CACCCAG | Region 668-692 · 1 3D model | Open · Scan | |
| TFS_sp_Q86V15_CASZ1_HUMAN:668:692_5ke7_A_1 | ModCRE | Homology model | CGGGCGGGGT | Region 668-692 · 1 3D model | Open · Scan | |
| TFS_sp_Q86V15_CASZ1_HUMAN:668:692_6vtx_A_1 | ModCRE | Homology model | GGCCCGCGGGGC | Region 668-692 · 1 3D model | Open · Scan |
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
1759 aa
668-692
1454-1486
Region 1454-1486 2 PWM
- Residues
- 33 aa
- Domains
- PF26743 · CASZ1-like, zinc finger
- 3D models
- 2 active PDBs · 2 summary rows
- Templates
- 5YJ3
- Sources
- Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
5 active PDB models
5 summary rows
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 668-6923 models · 3 summary rows
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_sp_Q86V15_CASZ1_HUMAN:668:692_2wbs_A_1 | 2wbs | 668-692 | View model · PDB |
| Predicted = Low | TFS_sp_Q86V15_CASZ1_HUMAN:668:692_5ke7_A_1 | 5ke7 | 668-692 | View model · PDB |
| Predicted = Low | TFS_sp_Q86V15_CASZ1_HUMAN:668:692_6vtx_A_1 | 6vtx | 668-692 | View model · PDB |
Model-summary evidence imported for this region.
| Rank | Template | Domain | N-tails | C-tails | Chains | Identity / similarity | Coverage | Model file |
|---|---|---|---|---|---|---|---|---|
| 3 | 6vtx | 1454:1486 | 668 | 692 | P:A · DNA:B,C | 44.0% / 64.0% | 30 | View · PDB TFS_sp_Q86V15_CASZ1_HUMAN:668:692_6vtx_A_1 |
| 4 | 5ke7 | 1454:1486 | 668 | 692 | P:A · DNA:B,C | 44.0% / 64.0% | 28 | View · PDB TFS_sp_Q86V15_CASZ1_HUMAN:668:692_5ke7_A_1 |
| 5 | 2wbs | 1454:1486 | 668 | 692 | P:A · DNA:F,G | 44.0% / 64.0% | 28 | View · PDB TFS_sp_Q86V15_CASZ1_HUMAN:668:692_2wbs_A_1 |
Region 1454-14862 models · 2 summary rows
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_sp_Q86V15_CASZ1_HUMAN:1454:1486_5yj3_C_1 | 5yj3 | 1454-1486 | View model · PDB |
| Predicted = Low | TFS_sp_Q86V15_CASZ1_HUMAN:1454:1486_5yj3_D_1 | 5yj3 | 1454-1486 | View model · PDB |
Model-summary evidence imported for this region.
| Rank | Template | Domain | N-tails | C-tails | Chains | Identity / similarity | Coverage | Model file |
|---|---|---|---|---|---|---|---|---|
| 1 | 5yj3 | 1454:1486 | 1454 | 1486 | P:C · DNA:A,B | 45.5% / 63.6% | 44 | View · PDB TFS_sp_Q86V15_CASZ1_HUMAN:1454:1486_5yj3_C_1 |
| 2 | 5yj3 | 1454:1486 | 1454 | 1486 | P:D · DNA:A,B | 45.5% / 63.6% | 46 | View · PDB TFS_sp_Q86V15_CASZ1_HUMAN:1454:1486_5yj3_D_1 |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 464-523 | PF30733 | CASZ1-like, zinc finger 1 | No overlap with loaded model regions |
| 526-581 | PF26743 | CASZ1-like, zinc finger | No overlap with loaded model regions |
| 584-639 | PF26743 | CASZ1-like, zinc finger | No overlap with loaded model regions |
| 643-695 | PF26743 | CASZ1-like, zinc finger | overlaps 668-692 |
| 1160-1207 | PF26743 | CASZ1-like, zinc finger | No overlap with loaded model regions |
| 1219-1270 | PF26743 | CASZ1-like, zinc finger | No overlap with loaded model regions |
| 1276-1327 | PF26743 | CASZ1-like, zinc finger | No overlap with loaded model regions |
| 1432-1487 | PF26743 | CASZ1-like, zinc finger | overlaps 1454-1486 |
| 1490-1543 | PF26743 | CASZ1-like, zinc finger | No overlap with loaded model regions |
| 1547-1599 | PF26743 | CASZ1-like, zinc finger | No overlap with loaded model regions |