Region 214-294 0 PWM
- Residues
- 81 aa
- Domains
- PF00105 · Double treble clef zinc finger, C4 type
- 3D models
- 1 active PDB
- Templates
- 1A6Y
- Sources
- Structure model
Transcription factor
Q86WD1 - PPARG
Peroxisome proliferator-activated receptor gamma (PPAR-gamma) (Nuclear receptor subfamily 1 group C member 3)
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 584 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M11139_2.00 | Known | CisBP | AAGTAGGTCACCGTGACCTACTT | Direct PWM | Open · Scan |
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
584 aa
214-294
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 214-2941 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | DIMER_Q86WD1:214:294_1a6y_B_1 | 1a6y | 214-294 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 110-187 | PF12577 | PPAR gamma N-terminal region | No overlap with loaded model regions |
| 217-283 | PF00105 | Double treble clef zinc finger, C4 type | overlaps 214-294 |
| 398-564 | PF00104 | Ligand-binding domain of nuclear hormone receptor | No overlap with loaded model regions |